Ab32500

Chromatin immunoprecipitation analysis and luciferase reporter assays were performed in our previous study.^{9 (link)} The following antibodies were applied including AR (ab74272, Abcam) and STAT3 (ab32500, Abcam) antibodies. Rabbit anti-IgG antibodies (2729, CST) served as a negative control. RT-PCR was performed with specific primers flanking the AR-binding site (forward: 5’- TGGAAGCCGAGGAACAGGGTCA −3’; reverse: 5’- GCGTGGAGATGGGCAGGGTTAA −3’) in the HMGB1 promoter and the STAT3-binding site (forward: 5’-TCCAGAGTGAGGTTCAGCCTTT-3’; reverse: 5’- CTCTAGGCCATCCTGCCTTTCT-3’) in the gankyrin promoter.
The AR-binding sites of the HMGB1 promoter (sequence: AGGAACAGGGTCAGC, +1159 to +1173 from the HMGB1 transcription site) and the STAT3-binding sites of the gankyrin promoter (sequence: CTGTTTAGAAA, +177 to +187 from to the gankyrin transcription site) or their mutant sequences were cloned into the pGL3-basic luciferase reporter vector; the pRL-TK Renilla luciferase plasmid (Promega, USA) was applied for transfection efficiency normalization. Cells were harvested at 2 day after transfection, and HMGB1 and gankyrin transcription activities were calculated via detecting luminescence with a Dual-Luciferase Assay Kit (Promega, USA). The fold induction value was calculated relative to Renilla luciferase activity.

Radioimmunoprecipitation assay lysis buffer (Millipore, Billerica, MA, USA) was used to extract the total protein, as per the user's manual book. The operating procedures were in accordance with the report of Lai et al.²⁰ The primary antibodies from Abcam (Cambridge, MA, USA) were exhibited as follows: anti‐B‐cell lymphoma‐2 (anti‐Bcl‐2; ab32124, 1:1000), anti‐Bcl‐2 associated X (anti‐Bax; ab32503, 1:1000), anti‐cleaved‐caspase‐3 (ab2302, 1:1000), anti‐CDK16 (ab15467, 1:1000), anti‐JAK2 (ab108596, 1:1000), anti‐phosphorylated‐JAK2 (anti‐p‐JAK2; ab32101, 1:1000), anti‐STAT3 (ab32500, 1:100), anti‐phosphorylated‐STAT3 (anti‐p‐STAT3; ab76315, 1:1000), and anti‐GAPDH (ab181602, 1:3000). After the incubation with anti‐rabbit IgG, HRP‐linked secondary antibody (ab205718, 1:5000), the protein blots were visualized on the membranes using ECL Ultra Western HRP Substrate (Millipore). Data analysis was completed by ImageLab software version 4.1 (Bio‐Rad, Hercules, CA, USA).

Paraffin-embedded sections of prostate cancer samples were deparaffinized, rehydrated, and microwaved for 20 min in Tris/EDTA buffer or citric acid buffer to retrieve antigens. Staining was carried out using primary antibodies against the following proteins: Gankyrin (ab182576, Abcam), HMGB1 (ab18256, Abcam), CD68 (M0876, Dako), STAT3 (ab32500, Abcam), p-STAT3 (ab76315, Abcam), and NONO (11058, Proteintech). Samples were scored semiquantitatively according to the percentage of staining intensity and positive cells using the H score (range 0–300), as described previously.^{20 (link)} All the immunohistochemistry assays were repeated three times.

A ChIP assay was performed using a Magna ChIP kit (Millipore, Billerica, MA, USA) according to the manufacturer’s manual. Briefly, 1 × 10⁷ SGC-7901 cells were fixed with formaldehyde (1%, Sigma) and the nuclear isolation was extracted. Then, the isolation was purified and sonicated into fragments (200–1,000 bp) and immunoprecipitated with anti-STAT3 antibody (Abcam, ab32500, 1:1,000) or anti-immunoglobulin G (IgG). The putative transcriptional binding sites were predicted by JASPAR (http://jaspar.genereg.net/). The immunoprecipitated complex was collected and the reverse transcription was detected by real-time PCR normalized to input control.