S cerevisiae eby100

pYD1 plasmid (Invitrogen, San Diego, CA) was used to construct SARS-CoV-2 RBD surface display vector. Escherichia coli Top10 was the host strain used for the construction of expression vector and propagated in Luria–Bertani (LB) broth (1% peptone, 0.5% yeast extract and 1% sodium chloride) at 37°C. S. cerevisiae EBY100 (Invitrogen, San Diego, CA) served as a host cell for RBD and its variants’ surface display and grown in YNB-CAA-Glucose medium (0.67% yeast nitrogen base without amino acids, 0.5 casamino acids, 2% glucose) at 30°C. Minimal dextrose medium (0.67% yeast nitrogen base without amino acids, 2% dextrose, 0.01% leucine, 2% agar) was used to select yeast transformants.

The HA gene (1632 bp) of A/Anhui/1/2013 (AH-H7N9) was PCR-amplified from pCDNA3.1/H7N9/HA using the following primers: HA-F: CTAGCTAGCAATGCAGACAAAATC (Nhe I); HA-R: CCGGAATTCTATACAAATAGTGCACC (EcoRI) and subcloned into the yeast display plasmid, pYD5, which was kindly provided by Dr. Z Wang [11 (link)] and allowed the NH₂ terminus of the displayed protein of interest to be free. The shuttle plasmid pYD5-HA was transformed into competent Escherichia coli DH5α (New England Biolabs, Beverly, MA) and then electroporated into competent S.cerevisiae EBY100 (Invitrogen, San Diego, CA). Recombinant yeast transformants were grown on selective plate which contained 0.67% yeast nitrogen base (YNB) without amino acids, 2% dextrose, 0.01% leucine, 2% agar and 1 M sorbitol at 30 °C for 3 days. Single positive clone S.cerevisiae EBY100/pYD5-HA was selected and cultured in 3 mL of YNB-CAA (20 g/L dextrose, 6.7 g/L yeast nitrogen base without amino acids, 13.61 g/L Na₂HPO₄, 7.48 g/L NaH₂PO₄ and 5 g/L casamino acids) overnight at 30 °C with shaking. Inducible expression of S.cerevisiae EBY100/pYD5-HA was performed in YNB-CAA medium where dextrose was replaced by 20 g/L of galactose at 20 °C for 3 days with shaking. Meanwhile, S.cerevisiae EBY100 containing empty pYD5 was used as a negative control for the following tests.

Escherichia coli (E. coli) (New England Biolabs, Beverly, MA), S. cerevisiae shuttle plasmid pYD1 (Invitrogen, San Diego, CA), and pcDNA3.1/H5N1/HA/optimized plasmid were used to construct an HA surface display vector. S. cerevisiae EBY100 (Invitrogen) served as a host cell for HA surface display. The secretion signal and transmembrane region truncated H5N1 HA gene fragment of A/Vietnam/1203/2004 was PCR-amplified and subcloned into pYD1. The resultant shuttle plasmid pYD1-HA was electroporated into S. cerevisiae EBY100. Recombinant yeast transformants were plated on selective minimal dextrose plates containing amino acids (0.67% yeast nitrogen base without amino acids (YNB), 2% glucose, 0.01% leucine, 2% agar, and 1 M sorbitol). Trp⁺ transformants were selected after 3 days of growth. The positive colonies were confirmed by DNA sequencing. Recombinant yeast were cultured in YNB-CAA-Glu (0.67% YNB, 0.5 casamino acids, 2% glucose) and induced by 2% galactose for HA production. S. cerevisiae EBY100 bearing pYD1 plasmid served as a negative control for all the experiments.