Lysozyme m cre mice

Manufactured by Jackson ImmunoResearch

Sourced in United States

Lysozyme M-Cre mice are genetically modified mice that express Cre recombinase under the control of the lysozyme M promoter. Cre recombinase is an enzyme that can be used to selectively remove or inactivate target DNA sequences in specific cell populations.

Automatically generated - may contain errors

Lab products found in correlation

8 protocols using lysozyme m cre mice

Genetically Engineered Mouse Models for NLRP3 Studies

Cited 3 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

Casp1^−/− were kindly provided by Dr. Thirumala-Devi Kanneganti (St. Jude Children's Research Hospital). Cre-ER^TM (B6.Cg-Tg(CAG-cre/Esr1*)5Amc/J) mice and lysozyme M-Cre mice were purchased from The Jackson Laboratory (Sacramento, CA). Nlrp3^fl(D301N)/+ mice were kindly provided by Dr. Hal Hoffman (University of California, San Diego), and have been previously described (52 (link), 54 (link), 85 (link)). Nlrp3^CA/+ mice with constitutive activation of NLRP3 in myeloid cells driven by lysozyme M-Cre have been previously described (54 (link)). Cre-ER^TM mice and Nlrp3^fl(D301N)/+ mice were crossed to generate Nlrp3^fl(D301N)/+;Cre-ER^TM mice and Cre-ER^TM mice. Injection of tamoxifen (i.p., 75 mg/kg body weight; Sigma-Aldrich) to Nlrp3^fl(D301N)/+;Cre-ER^TM mice and Cre-ER^TM mice to yield inducible Nlrp3^CA (iNlrp3^CA) mice and control mice, respectively, has been previously described (85 (link)). Gsdmd^−/− mice were kindly provided by Dr. V. M. Dixit (Genentech, South San Francisco, CA). Asc-citrine and Gsdme^−/− mice were purchased from The Jackson Laboratory (Sacramento, CA). All mice were on the C57BL6J background and mouse genotyping was performed by PCR. All procedures were approved by the Institutional Animal Care and Use Committee of Washington University School of Medicine in St. Louis.

Wang C., Yang T., Xiao J., Xu C., Alippe Y., Sun K., Kanneganti T.D., Monahan J.B., Abu-Amer Y., Lieberman J, & Mbalaviele G. (2021). NLRP3 inflammasome activation triggers gasdermin D-independent inflammation. Science immunology, 6(64), eabj3859.

+ Open protocol

+ Expand

Genetically Modified Mice for Immunological Research

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Lysozyme M-Cre mice, CD8 knockout mice and perforin knockout mice were purchased from Jackson laboratory (Bar Harbor, ME, USA), and STAT3^flx/flx mice have been described (15 (link)). These mice were backcrossed to the FVB/N background more than 10 times. All animals were housed under specific pathogen-free conditions at the Hillman Cancer Center of the University of Pittsburgh Cancer Institute. Animal experiments were approved by the Institutional Animal Care and Use Committee (IACUC) of the University of Pittsburgh.

Zhou J., Qu Z., Sun F., Han L., Li L., Yan S., Stabile L.P., Chen L.F., Siegfried J.M, & Xiao G. (2017). Myeloid STAT3 promotes lung tumorigenesis by transforming tumor immunosurveillance into tumor-promoting inflammation. Cancer immunology research, 5(3), 257-268.

+ Open protocol

+ Expand

Generation and Characterization of Mcu Mice

Check if the same lab product or an alternative is used in the 5 most similar protocols

Mcu^fl/fl mice were generated by using MCU-conditional targeting embryonic stem cells (ES cell strain JM8A3.N1, C57BL/6 background) obtained from the European Conditional Mouse Mutagenesis Program (EUCOMM; ID: 93748). For genotyping Mcu^fl/fl mice, tail genomic DNA was isolated and then amplified by PCR using the following primers: Primer 1: GTCTGTGTTCGTAGTACTTGTACGTTCA; Primer 2: AGAGAAGTGACTTCCACAGGTTGT. The PCR condition was: 95°C 3 min; 95°C 30 s; 60°C 60 s, 72°C 60 s, repeated for 35 cycles. Mcu^Δmye mice were further generated by crossing the Mcu^fl/fl mice with lysozyme M-Cre mice. C57BL/6 mice, lysozyme M-Cre mice and Cybb^−/− mice were purchased from Jackson Laboratories. Mcu^ΔmyeCybb^−/− DKO mice were generated by crossing Mcu^Δmye mice with Cybb^−/− mice. All mice were housed in SPF facilities and all in vivo experiments were conducted in accordance with the National Institute of Health Guide for the Care and Use of Laboratory Animals and the Institutional Animal Care and Use Committee (IACUC).

Li T., Kong L., Li X., Wu S., Attri K.S., Li Y., Gong W., Li L., Herring L.E., Asara J.M., Xu L., Luo X., Lei Y.L., Ma Q., Seveau S., Gunn J.S., Cheng X., Singh P.K., Green D.R., Wang H, & Wen H. (2021). Listeria monocytogenes upregulates mitochondrial calcium signaling to inhibit LC3-associated phagocytosis as a survival strategy. Nature microbiology, 6(3), 366-379.

+ Open protocol

+ Expand

Generation of Myeloid-specific AMFR-deficient Mice

Check if the same lab product or an alternative is used in the 5 most similar protocols

Myeloid-specific AMFR-deficient (LysM^CreAmfr^fl/fl) mice were generated by breeding Lysozyme M-Cre mice (Jackson Laboratory) with Amfr^fl/fl mice (clone B000405; KOMP Repository). Cre-negative Amfr^fl/fl littermates were used as controls. Primers for genotyping are shown in Table S4. All mice were kept in pathogen-free facilities at the Shanghai Jiao Tong University (Shanghai, China). All animal experiments were approved by the Animal Care and Use Committee of Shanghai Jiao Tong University and were performed according to “Animal Management Regulations” (revised 2017) formulated by the National Science and Technology Commission.

Zhang H., Wei R., Yang X., Xu L., Jiang H., Li M., Jiang H., Zhang H., Chen Z., Qian F, & Sun L. (2022). AMFR drives allergic asthma development by promoting alveolar macrophage–derived GM-CSF production. The Journal of Experimental Medicine, 219(5), e20211828.

+ Open protocol

+ Expand

Genetic Manipulation of Mouse Models

Check if the same lab product or an alternative is used in the 5 most similar protocols

All mice used in this study were on the C57BL/6 background and were housed in specific-pathogen-free conditions. Both male and female animals of 8–12 weeks were used for these experiments. All animal experiments and procedures were approved by the Garvan Institute of Medical Research/St Vincent's Hospital Animal Ethics Committee. C57BL/6 mice were from Australian BioResources (Moss Vale, NSW). The ROSA-CAG-lox-stop-lox-KikGR knock-in and Kaede mice were a kind gift from Michio Tomura and were backcrossed and maintained on the C57BL/6 background. To generate whole-body Kikume transgenic mice ROSA-CAG-lox-stop-lox-KikGR mice were crossed to Rosa26 Cre (Jackson Laboratories). Albino.B6 or C57BL/6 mice with spontaneous mutations in the tyrosinase gene (B6(Cg)-Tyr^c-2J/J) as well as CCR7^−/− and Lysozyme M Cre mice were obtained from Jackson Laboratories. Lysozyme M fluorescent reporter mice were generated by crossing Lysozyme M Cre mice to ROSA^mT/mG (Jackson Laboratories) mice. CD11b-deficient mice (B6.129S4-Itgam^tm1Myd/J) were a kind gift from Dr Karlheinz Peter and were on the C57BL/6 background.

Hampton H.R., Bailey J., Tomura M., Brink R, & Chtanova T. (2015). Microbe-dependent lymphatic migration of neutrophils modulates lymphocyte proliferation in lymph nodes. Nature Communications, 6, 7139.

+ Open protocol

+ Expand

Genetically Engineered Mouse Models for Imaging

Check if the same lab product or an alternative is used in the 5 most similar protocols

All mice used in this study were maintained on C57BL/6 (RRID:MGI:5656552) background and housed in specific pathogen-free conditions. All animal experiments and procedures were approved by the Garvan Institute of Medical Research/St Vincent's Hospital Animal Ethics Committee. Male and female mice were randomly assigned to treatment groups once tumors were established. C57BL/6 mice (RRID:MGI:5656552) were obtained from Australian BioResources (Moss Vale, NSW). Kaede mice (RRID:IMSR_RBRC05737; ref. 11 (link)) were a gift from Professor Michio Tomura and were maintained on C57BL/6 background. Ly6GCre-tdTomato (C57BL/6-Ly6 g (tm2621(Cre-tdTomato)Arte) neutrophil-specific reporter mice (12 (link)) were a gift from Professor Matthias Gunzer and crossed with B6.LSL td-Tomato (B6.Cg-Gt(ROSA)26Sor^{tm14(CAG-tdTomato)Hze}/J (IMSR, catalog no. JAX:007914 RRID:IMSR_JAX:007914) to generate BigRed/Catchup^IVM-red mice and crossed to Albino.B6 or C57BL/6 mice with spontaneous mutations in the tyrosinase gene (B6(Cg)-Tyr^c-2J/J) for imaging. Lysozyme M fluorescent reporter mice were generated by crossing lysozyme M Cre mice (Jackson Laboratory, catalog no. 004781 RRID:IMSR_JAX:004781) to B6-ROSA/kikGR(floxed) mice (Riken, # RBRC09254, RRID: IMSR_RBRC09254) or B6.Cg-Gt(ROSA)26Sortm14(CAG-tdTomato)Hze/J mice (Jackson Laboratory, catalog no. 007914 RRID: IMSR_JAX:007914).

Yam A.O., Bailey J., Lin F., Jakovija A., Youlten S.E., Counoupas C., Gunzer M., Bald T., Woodruff T.M., Triccas J.A., Goldstein L.D., Gallego-Ortega D., Grey S.T, & Chtanova T. (2023). Neutrophil Conversion to a Tumor-Killing Phenotype Underpins Effective Microbial Therapy. Cancer Research, 83(8), 1315-1328.

+ Open protocol

+ Expand

Inducible Myeloid VDR Knockout Mice

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

VDR^LoxP mice were originally developed by Dr. Geert Carmeliet (Department of Clinical and Experimental Medicine, KU Leuven, Leuven, Belgium). To obtain specific knockout of myeloid VDR (VDR^ΔLyz), we crossed VDR^LoxP mice with lysozyme(M)-cre mice (The Jackson Laboratory, Bar Harbor, ME, USA) (9 (link)). The mice were provided with water ad libitum and maintained in SPF conditions in Biology Research Laboratory of University of Illinois Chicago with 12-hour light/12-hour dark cycle. All animal work was approved by the University of Illinois Chicago (UIC) Committee on Animal Resources (Animal Protocol Number ACC 18-179).

Ruiz-Echevarría M.J., Yasenchak J.M., Han X., Dinman J.D, & Peltz S.W. (1998). The Upf3 protein is a component of the surveillance complex that monitors both translation and mRNA turnover and affects viral propagation. Proceedings of the National Academy of Sciences of the United States of America, 95(15), 8721-8726.

+ Open protocol

+ Expand

Generation and Characterization of Knockout Mice

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

C57BL/6 mice, lysozyme M-Cre mice, and Cybb^−/− mice were obtained from The Jackson Laboratory. GFP-LC3 transgenic mice (50 (link)), Mcu^fl/fl mice (18 (link)), and Rubcn^−/− mice (51 (link)) have been previously described. Mcu^Δmye mice were generated by crossing Mcu^fl/fl mice with lysozyme M-Cre mice (18 (link)). Mcu^ΔmyeCybb^−/− and Mcu^ΔmyeRubcn^−/− double knockout (DKO) mice were further generated by crossing Mcu^Δmye mice with Cybb^−/− mice and Rubcn^−/− mice, respectively. All mice were housed in specific pathogen-free facilities and all in vivo experiments were conducted in accordance with the National Institutes of Health Guide for the Care and Use of Laboratory Animals and the Institutional Animal Care and Use Committee. The study was approved by the Ethics Committee of The Ohio State University and all procedures were conducted in accordance with the experimental animal guidelines of The Ohio State University.

Dong H., Zhao B., Chen J., Liu Z., Li X., Li L, & Wen H. (2022). Mitochondrial calcium uniporter promotes phagocytosis-dependent activation of the NLRP3 inflammasome. Proceedings of the National Academy of Sciences of the United States of America, 119(26), e2123247119.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!