Sulforaphane

Manufactured by MedChemExpress

Sourced in United States

Sulforaphane is a naturally occurring compound found in cruciferous vegetables such as broccoli and cabbage. It is a powerful antioxidant and has been extensively studied for its potential health benefits. As a lab equipment product, sulforaphane can be used for research purposes to investigate its biological and physiological effects.

Automatically generated - may contain errors

Lab products found in correlation

Bcl2 associated x (bax), by Cell Signaling Technology (2 mentions) Rad001, by MedChemExpress (2 mentions) Mk2206, by MedChemExpress (2 mentions) Bcl 2, by Cell Signaling Technology (2 mentions) Pp242, by MedChemExpress (2 mentions) Cleaved caspase 9, by Abcam (2 mentions) Bafilomycin a1 baf a1 s1413, by Selleck Chemicals (1 mentions) Lps l2880, by Merck Group (1 mentions) Chloroquine cq hy 17589a, by MedChemExpress (1 mentions) H2o2 solution, by Merck Group (1 mentions) Compound c, by AbMole (1 mentions) Dimethyl sulfoxide (dmso), by Merck Group (1 mentions)

5 protocols using sulforaphane

Sulforaphane and Chloroquine Inhibition

Check if the same lab product or an alternative is used in the 5 most similar protocols

Sulforaphane (purity > 99%, HY-13755) and chloroquine (CQ, HY-17589A) were obtained from MedChemExpress (Shanghai, China). LPS (L2880) was bought from Sigma Aldrich (Shanghai, China). Bafilomycin A1 (Baf-A1, S1413) was purchased from Selleck Chemicals (Houston, TX, USA).

Shao D., Shen W., Miao Y., Gao Z., Pan M., Wei Q., Yan Z., Zhao X, & Ma B. (2023). Sulforaphane prevents LPS-induced inflammation by regulating the Nrf2-mediated autophagy pathway in goat mammary epithelial cells and a mouse model of mastitis. Journal of Animal Science and Biotechnology, 14, 61.

+ Open protocol

+ Expand

Antioxidant activity assessment

Check if the same lab product or an alternative is used in the 5 most similar protocols

Sulforaphane (purity > 99%, HY-13755) was obtained from MedChemExpress. H₂O₂ solution (Sigma, 323381) was bought from Sigma Aldrich (USA). Compound C (AbMole, M2238) was purchased from AbMole BioScience (Houston, TX, USA).

Shao D., Gao Z., Zhao Y., Fan M., Zhao X., Wei Q., Pan M, & Ma B. (2023). Sulforaphane Suppresses H2O2-Induced Oxidative Stress and Apoptosis via the Activation of AMPK/NFE2L2 Signaling Pathway in Goat Mammary Epithelial Cells. International Journal of Molecular Sciences, 24(2), 1070.

+ Open protocol

+ Expand

Sulforaphane-Mediated Regulation of miRNA

Check if the same lab product or an alternative is used in the 5 most similar protocols

Sulforaphane was purchased from MedChem Express (#HY-13755, MCE, Monmouth Junction, NJ, USA) and dissolved in DMSO (Sigma, Saint Louis, USA) at the concentration of 10mM and protected from light. It stored as small aliquots at -20°C for long term preservation. The primers for miR-12315 (HmiRQP4717), miR-1247-3p(HmiRQP3407), miR-33b-3p(HmiRQP0431), miR-320-5p (HmiRQP4731) and small nuclear RNA-U6 (RNU6, #HmiRQP9001) were obtained by Genecopoeia (Rockville, MD, USA). The sequence of miR-12315 inhibitor was: AUGGUGUCGGAAAAUCG UAGCCGAAGACACCUCGGACGA GAGACCGA CACCGCCA. The sequence of miR-1247-3p mimic was: CCCCGGGAACGUCGAGACUGGAGC. The sequence of miR-320a-5p inhibitor was: CGGAAGAGAAGGGCCAAGAAGG. The sequence of miR-33b-3p mimic was: CAGUGCCU CGGCAGUGCAGCCC. The sequence of inhibitor NC was: CAGUACUUUUGUGUAGUACAA.
The sequence of mimic NC was: UUGUACUACACAAAAGUACUG.

Luo M., Fan D., Xiao Y., Zeng H., Zhang D., Zhao Y., & Ma X. (2020). Anticancer Effect of Natural Product Sulforaphane by Targeting MAPK Signal through miRNA-1247-3p in Human Cervical Cancer Cells. Biointerface Research in Applied Chemistry, 11(1), 7943-7972.

+ Open protocol

+ Expand

Molecular Signaling Pathway Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Sulforaphane, PP242, MK2206, RAD001 were purchased from Med Chem Express (Monmouth Junction, NJ, USA). Primary antibodies p-Rictor (Thr1135), Rictor, p-Akt (Ser473), Akt (pan), PRAS40, p-PRAS40 (Thr246), p-p70S6K (Thr389), p70S6K, Bax, Bcl-2, were purchased from Cell Signaling Technology (Danvers, MA, USA), and Cleaved-caspase 9 were acquired from Abcam (Cambridge, UK). The second antibody was obtained from Zhongshan Golden Bridge Biotechnology (Beijing, China).

Lu Z., Zhang Y., Xu Y., Wei H., Zhao W., Wang P., Li Y, & Hou G. (2022). mTOR inhibitor PP242 increases antitumor activity of sulforaphane by blocking Akt/mTOR pathway in esophageal squamous cell carcinoma. Molecular biology reports, 49(1).

+ Open protocol

+ Expand

Molecular Signaling Pathway Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Lu Z., Zhang Y., Xu Y., Wei H., Zhao W., Wang P., Li Y., & Hou G. (2021). mTOR Inhibitor PP242 Increases Antitumor Activity of Sulforaphane by Blocking Akt/mTOR Pathway in Esophageal Squamous Cell Carcinoma.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!