One step primerscript rt pcr kit

Manufactured by Takara Bio

Sourced in Japan

The One Step PrimerScript RT-PCR Kit is a laboratory equipment product designed for reverse transcription and polymerase chain reaction (RT-PCR) in a single-step process. It provides the necessary reagents and enzymes to perform both RNA reverse transcription and DNA amplification in a single reaction tube.

Automatically generated - may contain errors

Lab products found in correlation

Qiaamp minelute virus spin kit, by Qiagen (2 mentions) Lightcycler 480, by Roche (2 mentions) Stepone software v2, by Thermo Fisher Scientific (1 mentions) Direct zol rna miniprep kit, by Zymo Research (1 mentions)

Close spelling variants of this product

PrimerScript RT-PCR kit PrimerScript RT kit PrimerScriptTM PCR kit RT-PCR kit RT kits

4 protocols using one step primerscript rt pcr kit

Quantitative Detection of SFTSV by RT-PCR

Check if the same lab product or an alternative is used in the 5 most similar protocols

The quantitative detection of SFTSV was performed by real time RT-PCR. RNA was extracted from tissue supernatants for virus isolation. The forward primer was SFTSV-S2-237s: 5′-GCA ACA AGA
TCG TCA AGG CAT CAG G-3′, the reverse primer was SFTSV-S2-400a: 5′-TGC TGC AGC ACA TGT CCA AGT GG-3′ and the MGB probe was SFTSV-S2-317MGB: 5′-CTG GTT GAG AGG GCA-3′. RT-PCR was performed
using a One Step PrimerScript RT-PCR Kit (Takara Bio, Kusatsu, Japan) and StepOne Real-Time RT-PCR System (Thermo Fisher Scientific), under the following conditions: 1 cycle of 42°C for 5
min and 95°C for 10 sec and 50 cycles of 95°C for 5 sec, and 64°C for 60 sec. The copy numbers were calculated using StepOne Software V2.1 (Thermo Fisher Scientific).

TATEMOTO K., ISHIJIMA K., KURODA Y., MENDOZA M.V., INOUE Y., PARK E., SHIMODA H., SATO Y., SUZUKI T., SUZUKI K., MORIKAWA S, & MAEDA K. (2022). Roles of raccoons in the transmission cycle of severe fever with thrombocytopenia syndrome virus. The Journal of Veterinary Medical Science, 84(7), 982-991.

+ Open protocol

+ Expand

SFTSV RNA Extraction and qRT-PCR Quantification

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from the supernatant of SFTSV treated LAD2 cells and serum of mouse models after SFTSV infection, using the QIAamp MinElute Virus Spin kit (Qiagen, German). The quantitative real-time PCR (qRT-PCR) was performed with the One-step Primer Script RT-PCR kit (TaKaRa, Japan) in a LightCycler 480 (Roche). Virus loads were determined as previously described and expressed as copy/mL (37 (link)).

Wang Y.N., Zhang Y.F., Peng X.F., Ge H.H., Wang G., Ding H., Li Y., Li S., Zhang L.Y., Zhang J.T., Li H., Zhang X.A, & Liu W. (2022). Mast Cell-Derived Proteases Induce Endothelial Permeability and Vascular Damage in Severe Fever with Thrombocytopenia Syndrome. Microbiology Spectrum, 10(3), e01294-22.

+ Open protocol

+ Expand

SFTSV RNA Extraction and qRT-PCR Quantification

Check if the same lab product or an alternative is used in the 5 most similar protocols

+ Open protocol

+ Expand

SARS-CoV-2 Quantification by RT-PCR

Check if the same lab product or an alternative is used in the 5 most similar protocols

Tissues were homogenized in TRNzol universal reagent by TGrinder H24(TIANGEN, China) and RNA was extracted using Direct-Zol RNA Miniprep kit (ZYMO RESEARCH). Viral gRNA was reverse transcribed and amplified by One Step PrimerScript RT-PCR Kit (TakaRa) using Ligtcycler 480II Real-Time PCR System (Roche) according to manufacturer’s instructions. Viral loads were calculated as viral RNA copies per mL or per mg tissue and the assay sensitivity was 100 copies. The target for amplification was SARS-CoV2 N (nucleocapsid) gene. The primers and probes for the targets were: N-F:5’- GGGGAACTTCTCCTGCTAGAAT-3’; N-R: 5’- CAGACATTTTGCTCTCAAGCTG -3’; N-P: 5’-VIC-TTGCTGCTTGACAGATT-BHQ1-3’
For quantification of viral loads by RT-PCR, a standard curve of Ct values to the copy number of viral RNA is generated with serial 10-fold dilutions of RNA transcribed from recombinant plasmid pcDNA3.1-nCoV N in vitro with a known copy number. The viral loads of each sample were converted with Ct value and the standard curve. Statistical analysis was performed by LightCycler 480 Software.

Li Y., Bi Y., Xiao H., Yao Y., Liu X., Hu Z., Duan J., Yang Y., Li Z., Li Y., Zhang H., Ding C., Yang J., Li H., He Z., Liu L., Hu G., Liu S., Che Y., Wang S., Li Q., Lu S, & Cun W. (2021). A novel DNA and protein combination COVID-19 vaccine formulation provides full protection against SARS-CoV-2 in rhesus macaques. Emerging Microbes & Infections, 10(1), 342-355.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!