Mx3005p instrument

Genomic DNA was extracted from fresh tissue specimens using the QIAamp DNA mini kit (Qiagen, Valencia, CA, USA) or from FFPE tissues using either the Promega Maxwell 16 CSC DNA FFPE kit or the QIAamp DNA FFPE Tissue kit according to the manufacturer’s manual. The purity, amount, and median size of the extracted DNA were measured by the Nanodrop 8000 UV-Vis spectrometer (Thermo Scientific Inc., Wilmington, DE, USA), Qubit 2.0 fluorometer (Life Technologies Inc., Grand Island, NY, USA), and 2200 TapeStation Instrument (Agilent Technologies, Santa Clara, CA, USA). In addition, ΔCt values were determined using real-time PCR (Agilent Technologies) with Mx3005p instrument (Agilent Technologies, USA), FFPE QC kit (Illumina, cat no. WG-321-1001), and Brilliant Ultra-Fast SYBR Green qPCR (Agilent Technologies, cat no. 600882). If DNA meets the quality criteria such as (i) purity to absorption ratio (260 nm/280 nm) > 1.8, 260 nm/230 nm > 1.8; (ii) total amount > 250 ng; (iii) degradation to ΔCt value < 2.0; or DNA median size > 0.35 kb, it is proceeded onto the sequencing step.

To detect the mRNA expression of genes, total RNA was extracted from the samples using TRIzol reagent (9109, Takara, Shiga, Japan) according to the manufacturer’s instructions. First-strand cDNA was synthesised from 1 µg of total RNA using a Prime Script RT reagent kit (RR047A, Takara). qPCR was performed using SYBR Premix Ex Taq II (RR820A; Takara) and assessed using an Agilent Mx3005P instrument. The abundance of mRNA for each gene of interest was normalised to that of 18S rRNA. The following primers were used: mZip1 Fw, GCTTCGAAGGTCAGGTGCTA; mZip1 Rv, GCAGCAGGTCCAGAAGACAT; hZIP1 Fw, TGAGCCTAGTAAGCTGTTTCGC; hZIP1 Rv, CAGGGCCTCATCTATGGCA; 18S, ACCGCAGCTAGGAATAATGGA; CAAATGCTTTCGCTCTGGTC.

To generate cDNA with the AffinityScript cDNA Synthesis Kit (Agilent Technologies, Rome, Italy), 1 μg of total RNA was used. cDNAs were diluted to a final concentration of 20 ng per reaction. Real-time qRT-PCR was performed in triplicate using Brilliant II SYBR Master Mixes (Agilent Technologies) on an Mx3005P Instrument (Agilent Technologies); the expression level of PIWIL genes was normalized against β-actin mRNA. Specific primer sets are reported in Table 1.

The relative mRNA levels of FGF2, BDNF, and GDNF genes in the in vitro bioengineered human embryonic stem cells were evaluated by qRT-PCR. These cells were divided into 4 groups: wildtype hESCs; wildtype hESCs + DOX; bioengineered hESCs; and bioengineered hESCs + DOX. Each group was analyzed in triplicates of 1.8 × 10⁻⁶ cells. Total RNA was extracted from cells, 48 hours after activation by doxycycline, using an RNeasy Lipid Tissue Mini Kit (cat. no. 74804, Qiagen) according to the manufacturer's instructions. The quantity, quality, and integrity of the RNA samples were determined using a nanophotometer and agarose gel electrophoresis under denaturing conditions. A High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems: 4368814) was employed to convert 2 μg of total RNA into cDNA, which was used in triplicate as a template for PCR reaction. qRT-PCR was performed with an Mx3005P instrument (Agilent Technologies, Santa Clara, CA, USA), with the TaqMan Gene Expression Master Mix (2x) (Life Technologies: PN 4369016) and TaqMan reagents (Table 1) in a volume of 20 μL. The following thermocycling conditions were used: 45 cycles for amplification (95°C for 10 minutes, followed by 95°C for 15 seconds and 60°C for 1 minute).The 2^−ΔΔCt method [25 (link)] was performed for relative quantification, and GAPDH was used as the housekeeping gene.

Viral or intracellular RNA was isolated with TRIzol reagent by following the manufacturer’s instructions (15596-026; Invitrogen, Carlsbad, CA, USA). The cDNA was generated by EasyScript’s first-strand cDNA synthesis supermix (AE301; TransGen Biotech, Beijing, China). A total of 1 µg RNA was used as a template for each cDNA synthesis reaction. cDNA was stored at −80°C until use. The quantitative real-time PCR (qPCR) was carried out on an Mx3005P instrument (Agilent Technologies, Stratagene, USA) using the Power SYBR green PCR master mix (2×) (4367659; ABI). Quantitative RT-PCR (qRT-PCR) amplification of the target fragment was carried out with initial activation at 95°C for 2 min, followed by 45 cycles at 95°C for 15 s, 57°C for 15 s, and 68°C for 20 s. All primers for qPCR were presented in Table S1.