Hiseq miseq sequencer

mRNA-Seq library construction and sequencing were performed by Novogen Bioinformatics Technology Co., Ltd (Hong Kong). Briefly, a library of insert size 250 ~ 300 bp was constructed, followed by its sequencing by pair-end readings of 150 bp. Following random mRNA fragmentation, cDNA was synthesized by using random hexamer primers and reverse transcriptase. Then the synthesis of the complementary strand was carried out following the Illumina mRNA Sequencing Sample Preparation Guide. A series of the end terminal repair and ligation of the pair-end sequencing adaptors was performed. The employed adapters were: 5' adapter 5'-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT and 3' adapter 5'-GATCGGAAGAGCACACGTCTGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG, where the six underlined bases correspond to the index. Size selection and PCR amplification enrichment were performed. The quality testing of the library was done using Qubit 2.0 and Bioanalyzer 2100, and the effective concentration of the library was quantified accurately by Q-PCR.
The mRNA-Seq libraries were sequenced by an Illumina HiSeq/MiSeq sequencer. Raw readings were filtered to eliminate low quality readings and adapters. Those readings containing sequences of adapters, or 10% of their indeterminate bases or more than 50% of low quality bases (Qscore < = 5), were eliminated.

Total RNA in the alfalfa root samples was isolated using Trizol Reagent (Invitrogen, Beijing, China) following the manufacturer’s instruction. The RNA quality was examined on 1% RNase free agarose gel, the purity was confirmed by a Nanodrop-2000 spectrophotometer (Thermo Scientific, DE, USA), the integrity was determined by an Agilent Bioanalyzer 2100 System (Agilent Technologies, CA, USA), and the precise concentration was determined by a Qubit 2.0 Fluorimeter (Life Technologies, CA, USA). The sequencing library was constructed using a NEBNext^® Ultra^™ RNA Library Prep Kit (NEB, USA) according to the manufacturer’s recommendations and index codes. After verifying the quality of the cDNA library obtained, the samples were sequenced with the Illumina HiSeq/MiSeq sequencer.