Chromatin immunoprecipitation (ChIP) was performed using the SimpleChip Plus Enzymatic ChIP kit (Cell Signaling) following manufacturer’s instruction. In brief, 2 × 106 of HL-1 cells were cross-linked with 1% formaldehyde and harvested for the preparation of nuclei suspension. Nuclear membrane was lysed by sonication. Five micrograms of chromatin was used for immunoprecipitation incubated with Mef2a (Abcam). Quantitative PCR was subsequently performed using the following primer sets (binding site 1, -1506 relative to TSS: forward: 5′-CCAGCTCATTTCCTTTACTT-3′, reverse: 5′- CAGACTGAGAGAAGTCACCA-3′; binding site 2, -2868 relative to TSS: forward: 5′-TAGTTGCTCACCAACCTTGG-3′, reverse: 5′-TGAGAGGCCAGGCTGCACACA-3′; and non-binding intron site: forward: 5′-AGGTATTATTCATTTAATTT-3′, reverse: 5′-ATAGTTTACTGAAGTTTTAC-3′). Data were normalized to the amount of input chromatin. To confirm the binding sequence, 4 ng of PCR fragment was sequenced using ABI 3730 DNA analyzer.
Simplechip plus enzymatic chip kit
Manufactured by Cell Signaling Technology
Sourced in United States
The SimpleChip Plus Enzymatic ChIP kit is a laboratory product designed for chromatin immunoprecipitation (ChIP) experiments. It utilizes an enzymatic approach to fragment chromatin, facilitating the isolation and analysis of DNA regions associated with specific proteins of interest.
Automatically generated - may contain errors
Lab products found in correlation
Mef2a, by Abcam (1 mentions)
Protein g magnetic beads, by Thermo Fisher Scientific (1 mentions)
Anti c ebpβ antibody, by Santa Cruz Biotechnology (1 mentions)
Normal rabbit igg, by Santa Cruz Biotechnology (1 mentions)
Chip grade magnetic beads, by Cell Signaling Technology (1 mentions)
Control rabbit igg antibody, by Cell Signaling Technology (1 mentions)
Normal rabbit igg, by Cell Signaling Technology (1 mentions)
Lipofectamine 2000 reagent, by Thermo Fisher Scientific (1 mentions)
Magnetic beads, by Cell Signaling Technology (1 mentions)
Online primer design tool, by Sangon (1 mentions)
9 protocols using simplechip plus enzymatic chip kit
1
ChIP-qPCR and Sequencing of Mef2a Binding
2
ChIP-qPCR Validation of TRPC6 Gene Regulation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Chromatin-immunoprecipitation assay coupled with quantitative PCR (ChIP-qPCR) was conducted to validate the binding ability of PPARγ and p65 to the promoter region of the TRPC6 gene. The ChIP assay was performed according to the manufacturer’s protocol using a Simple ChIP Plus Enzymatic ChIP Kit (Cell Signaling Technology). For chromatin digestion, hPASMCs were treated with a protease inhibitor cocktail (PIC). Next, ChIP was performed using the protein G magnetic beads (Invitrogen), enriching anti-TRPC6 antibody or IgG (negative control) at 4°C overnight. After elution, the DNA–protein complexes were decrosslinked using proteinase K (CST) at 65°C for 2 h. Then, the resulting DNA fragments were purified and used for the PCR analysis and agarose gel separation (2%, Biowest, Nuaillé, France). We performed all reactions in triplicate. The primers used for ChIP-PCR are shown in Table 1 .
3
ChIP-qPCR Analysis of CEBPβ Binding
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Chromatin immunoprecipitation (ChIP) was performed using the SimpleChip Plus Enzymatic ChIP Kit (9004, Cell Signaling) following the manufacturer’s instructions. In brief, approximately 2 × 106 ARCM cells were cross-linked with 1% formaldehyde and harvested for the preparation of the nuclear suspension. Nuclear membrane was lysed by sonication. Fragmented chromatin was immunoprecipitated by anti-CEBPβ antibody (sc-7962, Santa Cruz Biotechnology). qPCR was subsequently performed using the primer sets detailed below. Data was normalized to input chromatin.
| Base pairs from TSS | 5' to 3' | |
|---|---|---|
| −429 to −259 | F | |
| R | ||
| −1,361 to −1,214 | F | |
| R | ||
| −2,104 to −1,913 | F | |
| R | ||
| −2,550 to −2,383 | F | |
| R | ||
| −3,528 to −3,383 | F | |
| R | ||
| −4,047 to −3,873 | F | |
| R | ||
| −4,176 to −4,026 | F | |
| R | ||
| −4,524 to −4,357 | F | |
| R |
4
TCF4 Binding Assay on CD44 Promoter
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
ChIP analysis for TCF4 occupancy on the promoter region of the CD44 gene was performed using the SimpleChIP Plus enzymatic ChIP kit (Cell Signaling). Briefly, formaldehyde cross-linked chromatin was isolated from 5 × 107 pancreatic cancer cells derived from AKC mice and sonicated into 500- to 1000-bp fragments. Ten micrograms of chromatin samples was diluted with ChIP dilution buffer to a final volume of 1 mL. Two percent of the sample was used as input chromatin. The remaining chromatin was incubated with 2 μg of ChIP-grade TCF4 antibody (Cell Signaling) and normal rabbit IgG (Santa Cruz Biotechnology) overnight at 4°C. ChIP-grade magnetic beads (Cell Signaling) were used for the pull-down. ChIP-enriched DNA was quantified by quantitative real-time PCR using primer sets described in Supplemental Table 4. The quality of the ChIP procedure was confirmed using PCR primers corresponding to a well-known β-catenin target sequence in the Axin2 promoter as a positive control and a region of the GAPDH coding region as a negative control.
Immunoprecipitated chromatin was normalized to input chromatin, and data are expressed as percentage of input.
Immunoprecipitated chromatin was normalized to input chromatin, and data are expressed as percentage of input.
5
ChIP-qPCR Profiling of CHOP Binding
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
ChIP with rabbit anti-CHOP (Cell Signaling Technologies) and control IgG rabbit antibody (Cell Signaling Technologies) was performed in Xbp1 and control silenced MODE-K cells by using a SimpleChIP Plus Enzymatic ChIP kit (Cell Signaling Technologies). Immunoprecipitated DNA was subject to qPCR to determine enrichment of CHOP binding to respective promoters (–431 to –272 bp relative to the start codon of Ulbp1), and results were normalized to input chromatin DNA. Primers used for qPCR were as follows: forward, 5′-TGTAGATCACCCTACCCAGCCT-3′ and reverse, 5′-TAAGAAGGACTCGAAGTGCAGGA-3′.
6
ChIP-qPCR Analysis of Transfected Acinar Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
266-6 acinar cells were transfected with pcDNA3-Flag-mXBP1s or empty plasmid using Lipofectamine 2000 reagent (Thermo Fisher, 11668019). Twenty hours after transfection, cells were cross-linked by 1% formaldehyde for 10 min at room temperature. ChIP was performed using SimpleChIP plus enzymatic ChIP kit with magnetic beads (Cell Signaling, 9005) following the protocol provided. Immunoprecipitation was performed with normal rabbit IgG (Cell Signaling, 2729) or ChIP-grade anti-Flag antibody (Cell Signaling, 14793). The primer sequences used for qPCR analysis were as follows: Shp, −190 bp (CAATGGCCACTTCATTGACTAA and ATACACACACACAATGCATACACG), Shp −2600 bp (AGTGTACGCTGAATAAACCCTTTC and CAGTGTCTTAGTCGGGGTTTCTAT), Shp +2400 bp (GGTTCTGAGCAAAAGAACCTCTTA and ACTGCCACCTTCATTATTTACCAT), Bip −100 bp (AACGAGTAGCGACTTCACCAAT and AAGTGTCCAGGTCAGTGTTGTCT), and Bip +2800 bp (AGGGAAGAAAGGTACAGTGATGAG and CCACACACACTTTAGGAAAAATGA).
7
ChIP-qPCR of CHOP-Hmgb1 Interaction
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Chromatin immunoprecipitation (ChIP) was performed using the SimpleChip Plus Enzymatic ChIP Kit (9004, Cell Signaling) as per manufacturer’s instructions. Briefly, control and CHOP-overexpressed H9C2 were fixed with 1% v/v formaldehyde and harvested. Nuclear membrane was lysed by sonication. Fragmented chromatin was immunoprecipitated by mouse anti-CHOP antibody. qPCR was subsequently performed using the following primer sets (See Key resources table ) (Sigma-Aldrich) designed from rat Hmgb1 (NC_051347) sequence. Data was normalized to input chromatin.
8
Sp1 Transcription Factor ChIP Assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
ChIP assays were performed using the SimpleChip Plus Enzymatic ChIP kit (Cell Signaling Technology, Danvers, MA, US) following the manufacturer’s instructions. In brief, protein and DNA in HL-1 cells were crosslinked with 1% formaldehyde. Chromatin was digested into DNA fragments of appropriate length (150-900 bp) using micrococcal nuclease and ultrasonic treatment. Enough chromatin was used for immunoprecipitation and incubated with a Sp1 antibody. Normal IgG was used as the negative control.
9
ChIP Assay for E2F1 Binding
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
ChIP assays were performed with Simple ChIP Plus Enzymatic ChIP Kit from Cell Signaling Technology (9005S, USA) according to the manufacturer's instructions. Quantitative PCR (qPCR) analysis was performed to detect the DNA fragments that coimmunoprecipitated with E2F1. The specific primer used for the E2F1 binding site within the Mfn-2 promoter was shown in Table 2 . The primers were designed by Sangon Biotech Online Primer Design Tool (Shanghai, China).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!