All the antibodies used in this study are listed in Supplementary Table 2 . Alexa-Fluor-conjugated-Dextran, Lysotracker dyes, Lysosensor dyes, BODIPY FL LDL, Phalloidin, and DAPI, were purchased from Molecular Probes (Invitrogen). SiR-Lysosome Kit was purchased from Cytoskeleton, Inc. Self-Quenched BODIPY FL conjugate of BSA was purchased from BioVision. Polybrene, Puromycin, EBSS, Rapamycin, and Bafilomycin A1 were purchased from Sigma-Aldrich.
Alexa fluor conjugated dextran
Manufactured by Thermo Fisher Scientific
Alexa-Fluor-conjugated-Dextran is a fluorescent labeling reagent. It consists of the polysaccharide dextran conjugated to Alexa Fluor dye. The dye provides a fluorescent signal that can be detected and measured using appropriate instrumentation.
Automatically generated - may contain errors
Lab products found in correlation
4 6 diamidino 2 phenylindole (dapi), by Thermo Fisher Scientific (2 mentions)
Lysosensor dyes, by Thermo Fisher Scientific (2 mentions)
Sir lysosome kit, by Cytoskeleton (2 mentions)
Self quenched bodipy fl conjugate of bsa, by Abcam (2 mentions)
Rapamycin, by Merck Group (1 mentions)
Bodipy fl ldl, by Thermo Fisher Scientific (1 mentions)
Bafilomycin a1, by Merck Group (1 mentions)
Polybrene, by Merck Group (1 mentions)
Puromycin, by Merck Group (1 mentions)
Lysotracker, by Thermo Fisher Scientific (1 mentions)
Dynasore, by Merck Group (1 mentions)
Alexa fluor conjugated phalloidin, by Thermo Fisher Scientific (1 mentions)
Filipin 3, by Merck Group (1 mentions)
Rabbit anti ha, by Merck Group (1 mentions)
Mouse anti gfp, by Roche (1 mentions)
Alexa fluor antibodies, by Thermo Fisher Scientific (1 mentions)
7 ketocholesterol, by Merck Group (1 mentions)
Rabbit anti cav 1, by BD (1 mentions)
Alexa fluor conjugated transferrin, by Thermo Fisher Scientific (1 mentions)
Phosstop phosphatase inhibitor cocktail, by Roche (1 mentions)
4 protocols using alexa fluor conjugated dextran
1
Lysosomal Imaging Reagents Protocol
2
Lysosome-Mediated Viral Entry Mechanisms
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All the DNA constructs and antibodies used in this study are listed in Supplementary Tables I and II , respectively. Most of the chemicals used in this study were purchased from Sigma-Aldrich. Alexa-fluor-conjugated-dextran, LysoTracker, LysoSensor dyes, EGF, and DAPI were purchased from Molecular Probes. The SiR-Lysosome Kit was purchased from Cytoskeleton, Inc., and the self-quenched BODIPY-FL conjugate of BSA was purchased from BioVision. Water-based ferrofluid (EMG 508) was purchased from Ferrotec Corporation. The chemical compounds, ML-098 and CID-1067700, were purchased from Cayman Chemicals.
The siRNA oligos for gene silencing were purchased from Dharmacon (Horizon Discovery) and prepared according to the manufacturer’s instructions. Transient transfection of siRNAs was performed using the DharmaFECT 1 reagent according to the manufacturer’s instructions. The following siRNAs were used in this study: control siRNA, 5’-TGGTTTACATGTCGACTAA-3’; ORF3a siRNA, 5’-GAGAATCTTCACAATTGGAACTGTA-3’56 (link); Rab7 siRNA, 5’-CTAGATAGCTGGAGAGATG-3’ and Vps39 siRNA 5’-CATTGCAGTGTTGCCTCGATATG-3’.
The siRNA oligos for gene silencing were purchased from Dharmacon (Horizon Discovery) and prepared according to the manufacturer’s instructions. Transient transfection of siRNAs was performed using the DharmaFECT 1 reagent according to the manufacturer’s instructions. The following siRNAs were used in this study: control siRNA, 5’-TGGTTTACATGTCGACTAA-3’; ORF3a siRNA, 5’-GAGAATCTTCACAATTGGAACTGTA-3’56 (link); Rab7 siRNA, 5’-CTAGATAGCTGGAGAGATG-3’ and Vps39 siRNA 5’-CATTGCAGTGTTGCCTCGATATG-3’.
3
Investigating Caveolae-Mediated Endocytosis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Mouse anti-CD44 (clone 5035-41.1D, Novus Biologicals), rabbit anti-CAV1 (BD Biosciences), rabbit anti-Caveolin2 (Sigma Aldrich), rabbit anti-Cavin-1 and Cavin-4 antibody were raised as described previously [16] (link), rabbit anti-Cavin-3 (ProteinTech group), mouse anti-Cavin-2 (Sigma Aldrich), rabbit anti-HA (Sigma Aldrich), mouse anti-Cdc42 (Becton Dickinson), mouse anti-GFP (Roche), mouse anti-transferrin receptor antibody (Zymed), Alexa Fluor conjugated dextran (Life Technologies), anti-rabbit and anti-mouse Alexa Fluor antibodies (Invitrogen), Alexa Fluor conjugated transferrin (Invitrogen), Alexa Fluor conjugated phalloidin (Invitrogen), Filipin III (Sigma Aldrich), Dynasore (Sigma Aldrich), 7-Ketocholesterol (Sigma Aldrich), Protease Inhibitor Cocktail Set III (Merck Millipore), PhosSTOP Phosphatase Inhibitor Cocktail (Roche), Dyngo-4a (Sigma). Stealth RNAi siRNA duplex oligonucleotides targeted against mouse Cavin-1 (5′CCGCUGUCUACAAGGUGCCGCCUUU3′ ;5′AAAGGCGGCACCUUGUAGACAGCGG3′ ) and Cavin-3 (5′CCGGAGCUCUGAAGGCCCAUCAGAA3′ ; 5′UUCUGAUGGGCCUUCAGAGCUCCGG3′ ) (Invitrogen).
4
Kinetics of Endocytosis in T. brucei
Check if the same lab product or an alternative is used in the 5 most similar protocols
T. brucei 221VB1.2 cells (5 x 106) were harvested per condition and cooled to 4°C to stop endocytosis. Cells were washed in TDB before being resuspended in TDB with the addition of either Dylight 488 labelled tomato lectin at 5 μg/ ml (Vector Labs), AlexaFluor 488 conjugated human transferrin at 50 μg/ ml (Life Technologies) or 10,000 MW AlexaFluor conjugated dextran at 5 mg/ ml (Life Technologies). Cells were subsequently transferred (without a wash step) to 37°C to re-activate endocytosis for 0, 0.5, 1, 2, 4, 8 or 16 minutes (in experiments following uptake of tomato lectin or transferrin) or 0, 1, 2, 4, 8, 16 or 32 minutes (in experiments following uptake of dextran). Cells were then washed in TDB, fixed in 2% PFA for 20 minutes and analysed by flow cytometry. Statistical analyses of VSG221 antibody clearance or uptake of the various endocytosis markers was performed by first fitting each data set to the non-linear regression model using the GraphPad Prism software. The half-time of uptake was then calculated for each data set and analysed using the Student’s t-test.
+ Expand
T. brucei 221VB1.2 cells (5 x 106) were harvested per condition and cooled to 4°C to stop endocytosis. Cells were washed in TDB before being resuspended in TDB with the addition of either Dylight 488 labelled tomato lectin at 5 μg/ ml (Vector Labs), AlexaFluor 488 conjugated human transferrin at 50 μg/ ml (Life Technologies) or 10,000 MW AlexaFluor conjugated dextran at 5 mg/ ml (Life Technologies). Cells were subsequently transferred (without a wash step) to 37°C to re-activate endocytosis for 0, 0.5, 1, 2, 4, 8 or 16 minutes (in experiments following uptake of tomato lectin or transferrin) or 0, 1, 2, 4, 8, 16 or 32 minutes (in experiments following uptake of dextran). Cells were then washed in TDB, fixed in 2% PFA for 20 minutes and analysed by flow cytometry. Statistical analyses of VSG221 antibody clearance or uptake of the various endocytosis markers was performed by first fitting each data set to the non-linear regression model using the GraphPad Prism software. The half-time of uptake was then calculated for each data set and analysed using the Student’s t-test.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!