Kapa2g taq polymerase

CRISPR/Cas9 system was used to introduce a frameshift mutation in Ndufs3 gene in B16-F10 murine melanoma cell line. In detail, Cas9 protein (Invitrogen #A36497) was transfected following manufacturer’s instructions using Lipofectamine CRISPRMAX Cas9 Transfection Reagent (Invitrogen #CMAX00015) together with synthetic RNA guides designed by Deskgen and purchased from Synthego. Exon 3 targeting guide TTGTGGGTCACATCACTCCG with PAM sequence GGG was used. Cells were split 48 hours after transfection and DNA was extracted using Mammalian Genomic DNA Miniprep Kit (Sigma-Aldrich #G1N350). Non-homologous repair efficiency was evaluated by Sanger Sequencing using KAPA2G Taq polymerase (Kapa Biosystems #KK5601) and Big Dye protocol (Life Technologies #4337451). In particular, 61°C annealing temperature was used for the PCR reaction, with primers forward CTGTAACTCCAGTCTCAGGGA and reverse CACACTGCAGGGATCACTTG. Manual clonal selection was performed in order to identify the cells with frameshift Ndufs3 mutations, leading to the generation of a pool of clones carrying the homozygous c.148A>G and c.150_151insCT mutations. DNA extraction from 96-well plates was performed using 8 μL of Lysis Solution (Sigma-Aldrich #L3289) and 80 μL of Neutralization Buffer (Sigma-Aldrich #N9784) per sample, following manufacturer’s instructions.