Agilent bioanalyzer with high sensitivity dna chips

The V1-2 region of the 16S rRNA gene for the bacterial community analysis was amplified using 27 F (AGRGTTYGATYMTGGCTCAG) and 337R (CTGCTGCCTYCCGTA) primers, while the ITS-1 region for fungi was amplified using ITS1-F (CTTGGTCATTTAGAGGAAGTAA) and ITS1-R (GTTCAAAGAYTCGATGATTCAC) primers. PCR amplification was performed using 2 × KAPA HiFi Hot Start ReadyMix (KAPA Biosystems, Wilmington, MA) according to the manufacturer’s instructions and the library preparation protocol from Illumina Inc. (https://jp.support.illumina.com/downloads/16s_metagenomic_sequencing_library_preparation.html). Libraries were quantified using the Qubit fluorometer with the Qubit dsDNA HS assay kit (Thermo Fisher Scientific, MA, USA) and the library size was assessed using the Agilent BioAnalyzer with high-sensitivity DNA chips (Agilent Technologies, CA, USA). Libraries were pooled at equimolar concentrations in preparation for sequencing.
Sequencing was performed using the Illumina MiSeq sequencer (Illumina, San Diego, CA, USA) with V3 reagents to generate 2 × 300-bp paired-end reads. Initial sequence data processing was performed using MiSeq Reporter software version 1.3.17.0 (Illumina, CA, U.S.A) to de-multiplex samples and remove adapters and primer sequences, and sequence data were then exported in the FASTQ format. Sequencing was performed within FASMAC Co., Ltd.