Phase lock gel tubes

Manufactured by Quantabio

Phase Lock Gel tubes are a specialized laboratory equipment used for the separation and purification of nucleic acids, such as DNA and RNA. These tubes contain a gel material that forms a physical barrier, trapping impurities and allowing the desired nucleic acids to be easily extracted.

Automatically generated - may contain errors

Lab products found in correlation

Miseq system, by Illumina (2 mentions) Trizol ls, by Thermo Fisher Scientific (2 mentions) Nanodrop spectrophotometer, by Thermo Fisher Scientific (2 mentions) Nanodrop reader, by Thermo Fisher Scientific (1 mentions) Gelred, by Biotium (1 mentions) Maxima h minus reverse transcriptase, by Thermo Fisher Scientific (1 mentions) Rnasin plus rnase inhibitor, by Promega (1 mentions) Dna clean concentrator, by Zymo Research (1 mentions) Rna clean concentrator 5, by Zymo Research (1 mentions) Sequencher 5, by Gene Codes (1 mentions) Quantitech reverse transcription kit, by Qiagen (1 mentions) Dynamo hs sybr green qpcr kit, by Thermo Fisher Scientific (1 mentions) Cfx maestro software, by Bio-Rad (1 mentions) Trizol, by Thermo Fisher Scientific (1 mentions) Cfx96 real time pcr detection system, by Bio-Rad (1 mentions) Lightcycler 1, by Roche (1 mentions) Rneasy mini kit, by Qiagen (1 mentions) Tissuelyser 2, by Qiagen (1 mentions) Retroscript kit, by Thermo Fisher Scientific (1 mentions) Nucleotide purification kit, by Qiagen (1 mentions)

Close spelling variants of this product

Phase Lock Gel light tubes Heavy Phase Lock Gel tubes Phase Lock Gel Heavy tubes 5PRIME Phase Lock Gel Light tubes 5PRIME Phase Lock Gel Heavy tubes Phase-lock gels

6 protocols using phase lock gel tubes

Full-length HCV RNA Sequencing

Check if the same lab product or an alternative is used in the 5 most similar protocols

Viral supernatants were processed as previously described (Fahnøe and Bukh 2019 ; Mejer et al. 2020 ). Briefly, 250 µl of sample were suspended in 750 µl of TRIzol LS (Thermo Fisher Scientific), and RNA was extracted using Phase lock gel tubes (Quantabio) followed by RNA Clean & Concentrator-5 (Zymo Research). Reverse transcription of full-length open reading frame (ORF) HCV RNA was performed with Maxima H minus reverse transcriptase (Thermo Scientific) with RNasin Plus RNase inhibitor (Promega) at 50°C for 120 min followed by 5 min at 85°C using genotype 2a specific primer (AGCTATGGAGTGTACCTAGTGT). Complementary DNA (cDNA) was treated with RNase H (20 min at 37°C) and amplified (35 cycles at 98°C for 10 s, 65°C for 10 s, and 72°C for 8 m) using Hot Start High-Fidelity Q5 DNA Polymerase (New England Biolabs) with genotype 2a specific forward (CTTGCGAGTGCCCCGGGAGG) and reverse (TGGAGTGTACCTAGTGTGTGCCGCTC) primers. Four separate PCRs of each sample were pooled, cleaned (DNA Clean & Concentrator, Zymo Research), and evaluated for size and purity on 1 per cent agarose gels stained with GelRed (Biotium). DNA concentration was estimated using a Nanodrop reader (Thermo Fisher) and PCR products were full-length sequenced using an array of 24 overlapping primers by Macrogen. Sequence analysis was performed using Sequencher 5.4.6 (Genecodes Corp.).

Galli A., Fahnøe U, & Bukh J. (2021). High recombination rate of hepatitis C virus revealed by a green fluorescent protein reconstitution cell system. Virus Evolution, 8(1), veab106.

+ Open protocol

+ Expand

Phage Genomic DNA Extraction and Sequencing

Check if the same lab product or an alternative is used in the 5 most similar protocols

Phage genomic DNA (gDNA) was isolated from 1.8 ml of the RAD2 working stock (∼10¹⁰ PFU/ml). Eighteen microliters of DNase (1 mg/ml) and 8 μl of RNase A (12.5 mg/ml) were added and incubated at 37°C for 30 min. Eighteen microliters of proteinase K (10 mg/ml) and 46 μl of SDS (20% stock solution) were added to the lysate and subsequently incubated for a further 30 min at 37°C. Genomic DNA was isolated from the lysate by phenol-chloroform extraction using Phase Lock Gel tubes (QuantaBio catalog no. 2302820) as described previously (64 (link)). Whole-genome sequencing was performed as 2 × 250 bp paired-end reads using an Illumina MiSeq system by the NPG, DNA Pipelines Informatics Group, Wellcome Trust Sanger Institute. The RAD2 genome was assembled de novo using the Iterative Virus Assembler (65 (link)) and annotated by Prokka (66 (link)). The consensus sequence was then subsequently screened against the GenBank database using BLAST (67 (link)) (https://blast.ncbi.nlm.nih.gov/Blast.cgi).

Dunstan R.A., Bamert R.S., Belousoff M.J., Short F.L., Barlow C.K., Pickard D.J., Wilksch J.J., Schittenhelm R.B., Strugnell R.A., Dougan G, & Lithgow T. (2021). Mechanistic Insights into the Capsule-Targeting Depolymerase from a Klebsiella pneumoniae Bacteriophage. Microbiology Spectrum, 9(1), 10.1128/spectrum.01023-21.

+ Open protocol

+ Expand

Quantitative PCR Analysis of Insect Tissues

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA from hemocyte, fat body or midgut was isolated following tissue collection by the protocol described above. RNA was extracted from each tissue in TRIzol (Life Technologies) using phase lock gel tubes (Quanta Bio), and isolated using manufacturer protocols. The concentration and quality of RNA samples was assessed using a NanoDrop spectrophotometer (Thermo Scientific) and cDNAs were synthesized from the corresponding RNA samples using the QuantiTech Reverse Transcription Kit (Qiagen). Synthesized cDNA samples were used as templates for quantitative PCR assays using DyNAmo HS SYBR green qPCR kits (Thermo Fisher Scientific) and gene-specific primers (S1 Table). Prepared qPCR mixtures were analyzed for RNA abundance using the CFX 96 Real-Time PCR Detection System (Bio-Rad) and normalized against the reference gene ribosomal protein S7 (AAEL009496, S1 Table). Collected data were analyzed using the Bio-Rad CFX Maestro software (Bio-Rad), and fold change values were calculated using the 2^-ΔΔCt method [42 (link)]. All reactions were run in duplicate (technical), and the gene expression differences reported were based on at least three independent experiments.

Kim I.H., Castillo J.C., Aryan A., Martin-Martin I., Nouzova M., Noriega F.G., Barletta A.B., Calvo E., Adelman Z.N., Ribeiro J.M, & Andersen J.F. (2020). A mosquito juvenile hormone binding protein (mJHBP) regulates the activation of innate immune defenses and hemocyte development. PLoS Pathogens, 16(1), e1008288.

+ Open protocol

+ Expand

Phage Genomic DNA Extraction and Sequencing

Check if the same lab product or an alternative is used in the 5 most similar protocols

+ Open protocol

+ Expand

Quantification of Hippocampal Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was isolated from dorsal hippocampal tissue after 3 to 8 wpi (weeks after injection). Briefly, tissue was lysed in 700‐μL Qiazol Lysis Reagent using a stainless steel bead in a TissueLyser II (Qiagen). Proteins were removed using Phase Lock Gel tubes (5 Prime; QuantaBio, Beverly, Massachusetts) supplemented with 140‐μL chloroform. RNA was isolated using the RNeasy Mini Kit (Qiagen). RNA samples were split for two independent first‐strand cDNA syntheses using the RETROscript Kit (Ambion/Thermo Fisher Scientific).
Thermocycling was performed in a LightCycler 1.5 (Roche, Mannheim, Germany) using the QuantiTect SYBR Green polymerase chain reaction (PCR) Kit (Qiagen). Gene‐specific primers (Table S2) were designed in silico and synthesized by MWG Operon (Ebersberg, Germany). Specificity and efficiency of primers was confirmed via BLAST analysis and semiquantitative PCR on hippocampal cDNA. In order to check for genomic impurities, gapdh primers were designed to bind in exons separated by an intron of 134 bp. qPCR reactions were performed on first‐strand cDNA samples in a total volume of 20 μL. Results were analyzed using the C_t method. Gene expression levels were normalized to the housekeeping gene gapdh.

Günther A., Luczak V., Gruteser N., Abel T, & Baumann A. (2019). HCN4 knockdown in dorsal hippocampus promotes anxiety‐like behavior in mice. Genes, Brain, and Behavior, 18(2), e12550.

+ Open protocol

+ Expand

Annealing and Digestion of M13mp18 DNA

Check if the same lab product or an alternative is used in the 5 most similar protocols

Annealing was carried out by mixing synthetic probes and M13mp18 DNA at a molar ratio of 13:1 in water, heating to 95°C for 10 minutes, and then slowly cooling to room temperature. Digestion of unconjugated regions of M13mp18 and the excess probes was performed by adding 20 U MBN (New England Biolabs) for every 2.5 μg of M13mp18, adding 10X MBN Reaction Buffer (New England Biolabs) to reach a final concentration of 1X, and incubating the mixture at 30°C for 15 mins. Endonuclease activity was quenched by adding an equal volume of phenol/chloroform/isoamyl alcohol (25:24:1) (Acros Organics, Morris, NJ) followed by centrifugation at 17,000g in phase lock gel tubes (Quantabio, Beverly, MA). The process was repeated once using pure chloroform to remove any residual phenol. The aqueous component containing DNA isolate was retrieved and further purified using a Nucleotide Purification Kit (Qiagen, Germantown, MD). Obtained DNA constructs were redispersed in DNAse-/RNAse-free water at a final concentration of 320 nM and diluted as needed for concentration-dependent studies. The samples were loaded on a 3% agarose gel in 1X TBE buffer with Gel Red nucleic acid dye (Phenix Research Products, Candler, NC) and imaged by EGel Imager system (Invitrogen, Carlsbad, CA) to confirm products.

Sethi K., Dailey G.P., Zahid O.K., Taylor E.W., Ruzicka J.A, & Hall A.R. (2021). Direct Detection of Conserved Viral Sequences and Other Nucleic Acid Motifs with Solid-State Nanopores. ACS nano, 15(5), 8474-8483.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!