Pcdna3

The human ARHGAP5‐AS1 cDNA (NR_027263.1) with a tag sequence (5’‐GTCGTATCCAGTGCGAATACCTCGGACCCTGCACTGGATACGAC‐3’) at the RNA 3’‐end was synthesised and cloned into pcDNA3.1 by Genewiz (Suzhou, China), which was named as WT. Mutants 1, 2 and 3 are plasmids with the A‐to‐G mutation at the 876, 890 or 928 base of WT. The full‐length ARHGAP5‐AS1 cDNA was also cloned into pCDH‐CMV‐MCS‐EF1α‐Puro. As a result, the resultant plasmid was designated A‐AS1. The full‐length ARHGAP5‐AS1 cDNA with inserted T7 promoter upstream and downstream from the cloning site was also cloned into pcDNA3.1. The resultant plasmid was designated pcDNA‐A‐AS1. Two ARHGAP5‐AS1 shRNAs (shA‐AS1‐1 or shA‐AS1‐2, respectively) or the negative control shRNA (shNC) (Table S3) were synthesised and cloned into pLKO.1 by Genewiz (Table S3). These plasmids were named shA‐AS1‐1, shA‐AS1‐2 or shNC. The cDNA for the HA‐tagged CSDE1 (NM_007158.6) and truncated versions of HA‐tagged CSDE1 were cloned into pcDNA3.1 (Genewiz, China). To guarantee the orientation and integrity of plasmids, Sanger sequencing was performed.

ScFvMC1 purification was performed as previously published [43 (link)]. Briefly, scFv-MC1 was cloned into the mammalian expression vector pcDNA3.1 (Genewiz, South Plainfield, NJ) and transfected into HEK293T, using Lipofectamine 2000 (Invitrogen, Carlsbad, CA). After 48 h of transfection, the scFv released into the conditioned medium was affinity purified using a Ni-Sepharose High Performance column (GE Healthcare, Port Washington, NY). The efficiency of purification was tested using an immunosorbent assay employed to assess the antigen–binding specificity of the scFvMC1, as previously described [43 (link)]. Starting material, flow through and eluted fractions were tested to check for proper enrichment of the purified material. The purified scFv-MC1 was checked on Coomassie-stained SDS-PAGE gel for proper molecular weight.