Sybr premix ex taq system

The RNA-seq analysis was performed by Biomarker Technologies Co., Ltd. (Beijing, China). Total RNA was isolated from broccoli seedlings using the RNA Pure kit for plants (Vazyme, Beijing, China). The PCR primers for 14 glucoraphanin biosynthesis-related genes were designed using Primer 5.0. A quantitative real-time PCR (qRT-PCR) analysis was conducted using the SYBR Premix Ex-Taq™ system (Q711, Vazyme). The reaction volume (10 μL) consisted of 1 μL template cDNA, 5 μL TB Green, 3.2 μL RNase-free water, 400 nM forward primer, and 400 nM reverse primer. The PCR program was as follows: 95 °C for 30 s; 40 cycles of 95 °C for 5 s and 60 °C for 30 s. An actin gene was used as the reference gene. Details regarding the primers designed for this study are provided in Table 1.

Total RNA from atrial tissue samples was extracted using TRIzol (Invitrogen) according to manufacturer's protocol. cDNA was generated with a PrimeScript RT reagent kit (Vazyme, China). The mRNA expressions of IL-1β, IL-6, and TNF-α in the samples were analyzed by real-time PCR using a SYBR Premix Ex Taq System (Vazyme, China). The relative levels of the mRNA transcripts for IL-1β (primers: forward TTCGACACATGGGATAACGAGG and reverse TTTTTGCTGTGAGTCCCGGAG), IL-6 (primers: forward CCTGAACCTTCCAAAGATGGC and reverse TTCACCAGGCAAGTCTCCTCA) and TNF-α (primers: forward GAGGCCAAGCCCTGGTATG and reverse CGGGCCGATTGATCTCAGC) were normalized to GAPDH (primers: forward CCTCAAGATCATCAGCAATG and reverse CCATCCACAGTCTTCTGGGT). The relative expressions were determined by the 2^−ΔΔCT method using GAPDH as an endogenous control.