a Ras+, Myc-induced mouse prostate cancer cell line from C57BL/6 mice (ATCC CRL-3310), were cultured in DMEM with 10 % fetal bovine serum, 1 mM sodium pyruvate, 10 mM HEPES, and 1 % penicillin-streptomycin at 37 °C in 5 % CO2. RM-1 cells were chosen as the experimental model because they are a model for a solid tumor, because RM-1 tumors have been shown to recruit active MDSC [35 (link)], and because they come from the same genetic background as VDR knockout mice.
C57bl 6 mice
Manufactured by American Type Culture Collection
Sourced in United States
C57BL/6 mice are a commonly used inbred mouse strain. They are a laboratory-bred strain of the house mouse (Mus musculus) and are widely used in biomedical research.
Automatically generated - may contain errors
Lab products found in correlation
Fetal bovine serum (fbs), by Thermo Fisher Scientific (5 mentions)
Rpmi 1640 medium, by Thermo Fisher Scientific (3 mentions)
Sodium pyruvate, by Thermo Fisher Scientific (2 mentions)
Hepa1 6, by American Type Culture Collection (2 mentions)
Hep3b, by Thermo Fisher Scientific (2 mentions)
Hepa1 6, by Thermo Fisher Scientific (2 mentions)
Anti f4 80, by Thermo Fisher Scientific (1 mentions)
Anti cd115, by Thermo Fisher Scientific (1 mentions)
Phytohemagglutinin (pha), by Thermo Fisher Scientific (1 mentions)
Balb c, by American Type Culture Collection (1 mentions)
Wild type mice, by Jackson ImmunoResearch (1 mentions)
Anti gr 1, by Thermo Fisher Scientific (1 mentions)
Anti cd11b, by Thermo Fisher Scientific (1 mentions)
Hepa1 6 cells, by American Type Culture Collection (1 mentions)
C57bl 6, by American Type Culture Collection (1 mentions)
C57bl 6 mice, by Charles River Laboratories (1 mentions)
C57bl 6 mice, by Janvier Labs (1 mentions)
Hep 2 cells, by American Type Culture Collection (1 mentions)
C57bl 6j, by Charles River Laboratories (1 mentions)
Hek blue htlr7 cells, by InvivoGen (1 mentions)
15 protocols using c57bl 6 mice
1
RM-1 Prostate Cancer Cell Culture
2
Tumor Immunology in Mouse Models
3
Melanoma and Hepatocellular Carcinoma Mouse Models
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Experiments for the melanoma model study were performed by Explicyte (Bordeaux, France) and animals were housed in the animal facility, Animalerie Mutualisée Bordeaux 1, which received approval B33–522–22 from the Bordeaux Ethical Committee (CEEA50 Comité d’éthique de Bordeaux). C57BL/6 mice were purchased from Charles River Laboratories, L'Arbresle, France. Melanoma B16F10 (ATCC CRL-6475) cells (1×106 cells/100 μL) were implanted subcutaneously in the right flank of C57BL/6 immunocompetent mice (8-week-old females). Tumor volume, survival, and body weight of the animals were measured and recorded 3 times per week. A tumor volume > 2,000 mm3 or a weight loss > 15% relative to the initial weight of the animal were considered as endpoints and the animal was sacrificed.
For the HCC model study, experiments were performed by Oncodesign (Dijon, France) and all animal procedures were submitted to the Animal Care and Use Committee of Oncodesign (Oncomet) and approved by French authorities (CNREEA agreement N° 91). C57BL/6 mice were purchased from Janvier Labs, Le Genest-Saint-Isle, France. Hepa 1–6 cells (ATCC CRL-1830; 1×106 cells/50 μL) were transplanted via intrasplenic injection into 100 C57BL/6 mice (aged 5–6 weeks old).
For the HCC model study, experiments were performed by Oncodesign (Dijon, France) and all animal procedures were submitted to the Animal Care and Use Committee of Oncodesign (Oncomet) and approved by French authorities (CNREEA agreement N° 91). C57BL/6 mice were purchased from Janvier Labs, Le Genest-Saint-Isle, France. Hepa 1–6 cells (ATCC CRL-1830; 1×106 cells/50 μL) were transplanted via intrasplenic injection into 100 C57BL/6 mice (aged 5–6 weeks old).
4
Characterization of Immune Cell Responses in Transgenic Mice
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Mice were kept under Specific pathogen free (SPF) conditions in IVC cages with a 12 h/12 h light dark cycle, a humidity of 55% + /- 5% at a room temperature of 21 + /− 1 °C. The following mouse strains were used in this study: C57BL/6 J from Charles River (Germany); hA3 transgenic mice26 (link), which contain the human Apobec3 gene locus, were crossed to generate EGT-315 Tlr3−/−Tlr7−/−Tlr9−/− hA3 mice; Tlr767 (link)-and Tlr968 (link)-deficient mice were used to isolate primary B cells for in vitro activation. Tlr3−/−Tlr7−/−Tlr9−/− triple deficient11 (link) mice; and T-bet deficient C57BL/6 mice (Tbx21 deficient69 (link)). For in vitro infections with ERV-GFP we used the B cell lymphoma WEHI-231 (ATCC CRL-1702), NIH-3T3 cell line (ATCC CRL-1658) and primary mouse embryonic fibroblasts (MEF) isolated from C57BL/6 mice. HEK-Blue hTLR7 Cells (InvivoGen) and HEK mTLR9 cells were used as reporter cells for Tlr7 and Tlr9 ligands respectively70 (link). For the indirect immunofluorescence assay HEp-2 cells (ATCC CCL-23) were used. For in vitro B cell activation we used 40LB cells37 (link).
5
Mouse Mammary Cancer Cell Lines and MDSC Culture
6
Isolation of Lymph Node Cells and Tumor Cell Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Lymph node cells were isolated from bilateral axillary, inguinal and popliteal lymph nodes of euthanized mice and splenocytes were obtained from spleens of the mice by lysing erythrocytes with lysis buffer (10mM KHCO3, 150mM NH4Cl, 10mM EDTA, PH7.4). BALB/c mice-derived EMT-6 breast cancer cells (EMT-6), C57BL/6 mice-derived B16 melanoma cells (B16) and C57BL/6 mice-derived GL261 glioma cells (GL261) (American Type Culture Collection) were maintained in RPMI 1640 supplemented with 10% (V/V) fetal bovine serum (FBS) (GIBCO) and antibiotics (100IU of penicillin/ml and 100IU of streptomycin/ml). All cells were cultured at 37°C in a 5% CO2 humidified incubator.
7
Culturing Hepatocellular Carcinoma Cell Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The human HCC cell line Hep3B and mice HCC cell line Hepa1-6 (syngeneic to C57BL/6 mice) were obtained from the American Type Culture Collection (Manassas, VA, USA). Hep3B cells were cultured in DMEM (Dulbecco modified Eagle medium) (Gibco, USA) supplemented with 10% heat-inactivated FBS (fetal bovine serum) (Gibco, USA) and 1% penicillin-streptomycin. Hepa1-6 cells were cultured in RPMI 1640 medium (Gibco, USA) supplemented with 10% heat-inactivated FBS and 1% penicillin-streptomycin. All cells were incubated at 37°C in a humidified chamber containing 5% CO2.
8
Osteoblast Differentiation under Wnt Inhibition
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
MC3T3-E1 cell line deprived from neonate C57BL/6 mice was purchased from American Type Culture Collection (CRL-2593, Massachusetts, USA) and cultured in DMEM (Gibco, NY, USA) supplemented with 10% fetal bovine serum (FBS, Gibco). Wnt/β-catenin signaling pathway inhibitor, ICG-001, was purchased from Selleck (Shanghai, China) and dissolved in DMSO with a concentration of 50mM. Cells were treated with gossypol with a concentration of 20nm for 24h, unless otherwise stated.
9
Culturing Human and Mouse HCC Cell Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The human HCC cell line Hep3B and mouse HCC cell line Hepa 1–6 (syngeneic to C57BL/6 mice) were obtained from the American Type Culture Collection (Manassas, VA, USA). Hep3B cells were cultured in DMEM medium (Thermo Fisher Scientific, Waltham, MA, USA) supplemented with 10% heat-inactivated FBS (Thermo Fisher Scientific) and 1% penicillin–streptomycin. Hepa 1–6 cells were cultured in RPMI 1640 medium (Thermo Fisher Scientific) supplemented with 10% heat-inactivated FBS and 1% penicillin–streptomycin. All cells were incubated at 37°C in a humidified chamber containing 5% CO2.
10
Generating CRISPR-Cas9 Knockout Mice
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
C57BL/6 mice were obtained from Cavens Laboratory Animal (Changzhou, China). CD8 ovalbumin T-cell receptor transgenic (Tg) OT-I mice were kindly provided by Professor Hai Qi (Tsinghua University). Hdac9-KO mice were generated in a C57BL/6 background using the clustered regularly interspaced short palindromic repeats (CRISPR)-Cas9 technique, as previously described.22 (link) The single guide RNA sequence was as follows: 5′-CGGACGACAGGATCCACCAC-3′. Mouse sequences were analyzed using Sequencher V.5.4 (GeneCodes, Ann Arbor, Michigan, USA). Primers used for genomic screening were as follows: forward 5′-GCTTACATGCGCTATTCAGGG3′, reverse 5′CTCCCATGGGTCGGTCTTATG3′. All mice were maintained under specific pathogen-free conditions, and experiments were performed at 6–8 weeks of age. Lewis lung carcinoma (LLC) cells and B16 melanoma cells derived from C57BL/6 mice were obtained from the American Type Culture Collection and maintained in Dulbecco’s modified Eagle’s medium (GIBCO, Nanjing, China) supplemented with 10% fetal bovine serum (FBS; Biolnd, Nanjing, China). LLC cells were infected with pMiT-ovalbumin retrovirus, packaged in 293 T cells, in the presence of 10 µg/mL polybrene after 24 hours of pretreatment with 250 ng tunicamycin (Sigma-Aldrich, Shanghai, China). Flow cytometry was performed to confirm ovalbumin expression in LLC cells.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!