Log In Sign up
The largest database of trusted experimental protocols

Emsa kit

Manufactured by Panomics
Visit Supplier
Sourced in United States

The EMSA (Electrophoretic Mobility Shift Assay) kit is a laboratory tool used to study protein-DNA interactions. It allows researchers to analyze the binding of proteins to specific DNA sequences. The kit includes all the necessary reagents and materials to perform the EMSA technique, which is a widely used method in molecular biology and biochemistry.

Automatically generated - may contain errors

Lab products found in correlation

Protease and phosphatase inhibitor cocktail, by Merck Group (2 mentions) Macs protein g microbeads, by Miltenyi Biotec (2 mentions) Macs separation column, by Miltenyi Biotec (2 mentions) Nuclear extract kit, by Active Motif (2 mentions) Shrna, by Thermo Fisher Scientific (1 mentions) P smad3, by Cell Signaling Technology (1 mentions) Nuclear extraction kit, by Panomics (1 mentions) Thermal cycler, by Takara Bio (1 mentions) Cl 1000 ultraviolet crosslinker, by Analytik Jena (1 mentions) Biodyne b nylon membrane, by Pall Corporation (1 mentions)

9 protocols using emsa kit

1

Analyzing Notch-mediated Smad Activation

Check if the same lab product or an alternative is used in the 5 most similar protocols
Activation/phosphorylation of Smad3 (p-Smad3) in lung fibroblasts was detected using antibodies from Cell Signaling (Cat. No. 9520). Notch 1 (Clone TRCN0000025902) and 3 (clone TRCN0000075570) were silenced with shRNA (Open Biosystems) in lung fibroblasts to test the contribution of each of these Notch receptors on Notch-mediated activation in lung fibroblasts. An electrophoretic mobility shift assay (EMSA) kit (Panomics, Fremont, CA) was used to detect Smad protein DNA binding activity in lung fibroblasts. 10 μg nuclear extract was mixed with a labeled Smad 3/4 binding element probe (Panomics, Fremont, CA, Cat. No. AY1042P) and analyzed. Attenuation of Smad activation was assessed by comparing the optical density of shifted bands among groups.
Cao Z., Lis R., Ginsberg M., Chavez D., Shido K., Rabbany S.Y., Fong G.H., Sakmar T.P., Rafii S, & Ding B.S. (2016). Targeting of the pulmonary capillary vascular niche promotes lung alveolar repair and ameliorates fibrosis. Nature medicine, 22(2), 154-162.
+ Open protocol
+ Expand
2

Nuclear Extract Preparation and EMSA Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
Neuron/glia were seeded onto 6-well plates. A commercially available nuclear extraction kit and EMSA kit were used to prepare nuclear extracts and conduct EMSA, respectively, according to the manufacturer’s instructions (Panomics, Fremont, CA, USA). As with our previous studies [6 (link),7 (link),33 (link)], nuclear extracts (5 μg) were reacted with NF-κB oligonucleotide (5′-AGTTGAGGGGACTTTCCCAGGC), AP-1 oligonucleotide (5′-CGCTTGATGAGTCAGCCGGAA), CREB oligonucleotide (5′-AGAGATTGCCTGACGTCAGAGAGCTAG), or Stat1 oligonucleotide (5′-ATCGTTCATTTCCCGTAAATCCCTA). The DNA/protein complexes in the membranes were visualized by enhanced chemiluminescence Western blotting reagents and quantitated using a computer image analysis system (IS1000; Alpha Innotech Corporation). Quantitative data were depicted under blots and the content in untreated control was defined as 1.0.
Chen W.Y., Chang C.Y., Li J.R., Wang J.D., Wu C.C., Kuan Y.H., Liao S.L., Wang W.Y, & Chen C.J. (2018). Anti-inflammatory and Neuroprotective Effects of Fungal Immunomodulatory Protein Involving Microglial Inhibition. International Journal of Molecular Sciences, 19(11), 3678.
+ Open protocol
+ Expand
3

NF-κB DNA Binding Assay in 6-OHDA Treated Cells

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
The presence of NF-ĸB DNA binding activity was assessed by a gel electromobility shift assay (EMSA) kit (Panomics, Inc., Fremont, CA, USA) [25 (link),33 (link)]. To this aim SH-SY5Y were seeded in 100 mm Petri dishes (1.5 × 106 cells) and differentiated as above described. The cells were treated with BJ 0.5% or 1% for 24 h, and then incubated with 50-µM 6-OHDA for 6 h. Afterwards, the nuclear proteins were extracted from cold PBS washed cells using a commercial kit for nuclear extraction (Panomics), observing manufacturer’s guidelines. First, protein amounts were determined employing a protein assay commercial kit (Bio-Rad Laboratory, Hercules, CA, USA). Then, DNA-protein binding reaction was carried out in supplied binding buffer containing 1 µL of probe (NF-κB 5′ AGTTGAGGGGACTTTCCCAGGC 3′), 4 µg of nuclear extracts and 1 µL poly(dI-DC) at 15 °C for 30 min. After resolving complexes on a 6% non-denaturing acrylamide gel, these were transferred onto positively charged nylon membranes, and cross-linked at 120 mJ/cm2 for 1 min using a UV-light cross-link instrument (UV Stratalinker 1800, Stratagene, San Diego, CA, USA). DNA-protein binding was detected using streptavidin-labeled horseradish peroxidase (HRP) conjugate with a chemiluminescent detection system.
Ferlazzo N., Cirmi S., Maugeri A., Russo C., Lombardo G.E., Gangemi S., Calapai G., Mollace V, & Navarra M. (2020). Neuroprotective Effect of Bergamot Juice in 6-OHDA-Induced SH-SY5Y Cell Death, an In Vitro Model of Parkinson’s Disease. Pharmaceutics, 12(4), 326.
+ Open protocol
+ Expand
4

PAK4-PPARγ Interaction Profiling

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
Nuclear and cytoplasmic fractions were separated using Nuclear Extract Kit following manufacturer’s instructions (Active Motif, Carlsbad, CA), and whole cell lysates were isolated using RIPA buffer supplemented with protease and phosphatase inhibitor cocktails (Sigma-Aldrich, Carlsbad, CA) as described earlier26 (link). Immunoprecipitation was performed with nuclear extracts (500 µg) by incubating with specific antibodies against PAK4, PPARγ and non-specific IgG using µMACS protein-G microbeads and MACS Separation Columns following the manufacturer’s instructions (Miltenyi Biotec, Auburn, CA). Electrophoretic mobility shift assays were performed with 5µg of nuclear extract to detect PPARγ DNA binding using EMSA Kit (Panomics) following manufacturer’s instructions. For supershift assay, specific antibodies against PAK4, PPARγ and IgG (2 µg) were pre-incubated with nuclear protein for 30 min before the addition of biotin-labeled probe. TF-TF interaction arrays and protein-DNA interaction arrays were performed using immunoprecipitated PAK4 from nuclear lysates of 4910 cells (Panomics, Fremont, CA) and described in detail in Supplementary Information.
Kesanakurti D., Maddirela D., Mohanam S., Kaur B, & Puduvalli V.K. (2017). A Novel Interaction of PAK4 with PPARγ to Regulate Nox1 and Radiation-Induced Epithelial-to-Mesenchymal Transition in Glioma. Oncogene, 36(37), 5309-5320.
+ Open protocol
+ Expand
5

Nuclear Protein Extraction and EMSA Analysis

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
Nuclear proteins were extracted from the cells and dissected cortical tissues using a commercially available nuclear extraction kit and an EMSA kit (Panomics, Fremont, CA, USA). As with our previous studies [31 (link)], nuclear extracts (5 μg) were reacted with AP-1 oligonucleotide (5′-CGCTTGATGAGTCAGCCGGAA), NF-κB oligonucleotide (5′-AGTTGAGGGGACTTTCCCAGGC), Stat oligonucleotide (5′-ATCGTTCATTTCCCGTAAATCCCTA), or CREB oligonucleotide (5′-AGAGATTGCCTGACGTCAGAGAGCTAG). The DNA/protein complexes in the membranes were visualized by enhanced chemiluminescence Western blotting reagents and quantitated using a computer image analysis system (IS1000; Alpha Innotech Corporation).
Wu C.C., Chang C.Y., Shih K.C., Hung C.J., Wang Y.Y., Lin S.Y., Chen W.Y., Kuan Y.H., Liao S.L., Wang W.Y, & Chen C.J. (2020). β-Funaltrexamine Displayed Anti-Inflammatory and Neuroprotective Effects in Cells and Rat Model of Stroke. International Journal of Molecular Sciences, 21(11), 3866.
+ Open protocol
+ Expand
6

NF-kB Activation in Murine Bone Marrow Macrophages

Check if the same lab product or an alternative is used in the 5 most similar protocols
Seventy-five percent confluent cultures of C57BL/6 BMM cells were placed in reduced serum media (0.5%) for 16–18 hours. The cells were stimulated with human recombinant TPO (100 ng/ml) for 30 minutes and nuclear proteins extracted as described by Andrews et al. (1991) (link) EMSA was performed on 7μg of nuclear protein using a commercially available EMSA kit and NF-kB probe according to the manufacturer’s instructions (Panomics).
Bethel M., Barnes C.L., Taylor A.F., Cheng Y.H., Chitteti B.R., Horowitz M.C., Bruzzaniti A., Srour E.F, & Kacena M.A. (2015). A Novel Role for Thrombopoietin in Regulating Osteoclast Development in Humans and Mice. Journal of cellular physiology, 230(9), 2142-2151.
+ Open protocol
+ Expand
7

PAK4-PPARγ Interaction Profiling

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
Nuclear and cytoplasmic fractions were separated using Nuclear Extract Kit following manufacturer’s instructions (Active Motif, Carlsbad, CA), and whole cell lysates were isolated using RIPA buffer supplemented with protease and phosphatase inhibitor cocktails (Sigma-Aldrich, Carlsbad, CA) as described earlier26 (link). Immunoprecipitation was performed with nuclear extracts (500 µg) by incubating with specific antibodies against PAK4, PPARγ and non-specific IgG using µMACS protein-G microbeads and MACS Separation Columns following the manufacturer’s instructions (Miltenyi Biotec, Auburn, CA). Electrophoretic mobility shift assays were performed with 5µg of nuclear extract to detect PPARγ DNA binding using EMSA Kit (Panomics) following manufacturer’s instructions. For supershift assay, specific antibodies against PAK4, PPARγ and IgG (2 µg) were pre-incubated with nuclear protein for 30 min before the addition of biotin-labeled probe. TF-TF interaction arrays and protein-DNA interaction arrays were performed using immunoprecipitated PAK4 from nuclear lysates of 4910 cells (Panomics, Fremont, CA) and described in detail in Supplementary Information.
Kesanakurti D., Maddirela D., Mohanam S., Kaur B, & Puduvalli V.K. (2017). A Novel Interaction of PAK4 with PPARγ to Regulate Nox1 and Radiation-Induced Epithelial-to-Mesenchymal Transition in Glioma. Oncogene, 36(37), 5309-5320.
+ Open protocol
+ Expand
8

Quantifying NFκB Activation by EMSA

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
Nuclear extracts from control and experimental cells (1 × 107) were prepared as described previously [12 (link)–14 (link)]. Aliquots (1μg) were used for the electrophoretic mobility shift assay using the NFκB DNA-binding protein detection system kit (Affymetrix). Briefly, the protein-binding biotinylated DNA probes (NFκB) were incubated with nuclear extracts prepared from control and experimental cells according to the manufacturer’s protocol (Panomics, Redwood City, CA). The DNA-protein binding reactions were performed at room temperature for 10 min in 10 mM Tris-Hcl pH 7.9, 50 mM NaCl, 5 mM MgCl2, 1 mM EDTA, and 1 mM dithiothreitol plus 1 μg of poly (dI-dC), 5% (v/v) glycerol, and ~10 ng of biotinylated NFκB probe. Protein DNA complexes were resolved from protein-free DNA on 6 % polyacrylamide gels (Invitrogen) at 4° C in 50 mM Tris, pH 8.3, 2 mM EDTA. DNA-protein complexes and rest of the gel contents were transferred to Biodyne B membrane (Pall, Ann Arbor, MI) for 60 min at 300 mA. The membranes now containing the DNA-protein complexes were UV cross linked and chemiluminescent detection of biotinylated DNA was performed using the Panomics EMSA kit.
Ayasolla K.R., Rai P., Rahimipour S., Husain M., Malhotra A, & Singhal P.C. (2015). Tubular Cell Phenotype in HIV-Associated Nephropathy: Role of Phospholipid Lysophosphatidic Acid. Experimental and molecular pathology, 99(1), 109-115.
+ Open protocol
+ Expand
9

Gel Shift Assay for Transcription Factor Binding

Check if the same lab product or an alternative is used in the 5 most similar protocols
The gel shift assay was performed using the EMSA kit purchased from Panomics. Nuclear extractions from control and Cd-treated HK-2 cells were used for the assay. The protein concentration of nuclei was measured using the BCA protein assay kit. Nuclear protein (3 μg) was incubated with 10 ng DNA probe (biotin-labeled binding sequence to transcription factor) and 1 μg poly d(I-C) with binding buffer for 30 min at 15 °C in a thermal cycler (Takara Bio). For the competition assay, 1,320 ng cold DNA probe was added. The protein-bound probe was electrophoresed on a 5.0% (w/v) TBE [Tris borate-ethylenediaminetetraacetic acid (EDTA)]-polyacrylamide gel in 0.5 × TBE buffer at 4 °C and then transferred to a Biodyne® B nylon membrane (Pall corporation, Port Washington, NY, USA) in 0.5 × TBE buffer. The membrane was fixed by UV crosslinking (CL-1000 Ultraviolet Crosslinker; UVP, Upland, CA, USA) with 120 mJ/cm2. The membrane was blocked and probed with Streptavidin-HRP. The chemiluminescence images were taken using a LAS-3000 device.
Lee J.Y., Tokumoto M., Fujiwara Y., Hasegawa T., Seko Y., Shimada A, & Satoh M. (2016). Accumulation of p53 via down-regulation of UBE2D family genes is a critical pathway for cadmium-induced renal toxicity. Scientific Reports, 6, 21968.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!