Pcdna3 flag p53

Manufactured by Addgene

Sourced in United States

The pcDNA3-FLAG-p53 vector is a commonly used plasmid for the expression of the p53 protein. It contains the p53 gene fused to a FLAG tag, allowing for the detection and purification of the expressed protein. This vector is designed for transient transfection in mammalian cell lines.

Automatically generated - may contain errors

Lab products found in correlation

6 protocols using pcdna3 flag p53

Optimizing Cellular Transfection with p53 Plasmid

Check if the same lab product or an alternative is used in the 5 most similar protocols

Commercial branched PEI with average Mw 25 kDa, MTX hydrate, DMEM/Nutrient Mixture F-12 Ham (DMEM/F-12) with L-glutamine cell culture medium and fluorescein isothiocyanate (FITC) were all obtained from Sigma-Aldrich (St. Louis, MO, USA). DAPI was from Invitrogen (Carlsbad, CA, USA). All chemicals were of analytical grade. The 6.07 kbp plasmid pcDNA3-FLAG-p53 (Addgene plasmid 10838, Cambridge, MA, USA) used in the experiments was produced and purified by a procedure developed by our research team and described in the literature [25 (link)].
All solutions were freshly prepared by using ultra-pure grade water, purified with a Milli-Q system from Millipore (Billerica, MA, USA). Cancer HeLa and C33A cells were purchased from Invitrogen and fibroblast cells from PromoCell (Heidelberg, Germany).

Albuquerque T., Neves A.R., Quintela T, & Costa D. (2022). The Influence of Circadian Rhythm on Cancer Cells Targeting and Transfection Efficiency of a Polycation-Drug/Gene Delivery Vector. Polymers, 14(4), 681.

+ Open protocol

+ Expand

Detection of p53 Ubiquitination

Check if the same lab product or an alternative is used in the 5 most similar protocols

Ubiquitination of p53 was detected as described previously (73 (link)). Briefly, HCT116 cells were transiently transfected with DnaK-V5 or control vector, Flag-p53, and HA-ubiquitin expression plasmids. After 48 h the cells were treated for 5 h with 20 μM MG132 (Millipore) and then were lysed under non-denaturating conditions (Cell Signaling). Ubiquitin aldehyde (R&D) was added to the lysate to a final concentration of 1 μM. Lysates were precleared with 50 μL of protein G Dynabeads (Thermo Fisher) for 1 h at 4 °C with a rotator at 20 rpm. anti-Flag antibody (Sigma Aldrich) was used to immunoprecipitate ubiquitinated p53 proteins, and mouse IgG1 (Sigma) was used as a control. Immunoprecipitated samples were resolved by SDS/PAGE (12% gel from Novex) and analyzed by Western blotting with anti-HA and anti-Flag (both from Sigma). To ensure correct protein expression and loading, input samples were immunoblotted with anti-V5 (Abcam), anti-Flag, anti–β-actin (Cell Signaling), and anti-HA. pcDNA3 flag p53 (Addgene plasmid no. 10838) was obtained from Thomas Roberts, Dana–Farber Cancer Institute, Harvard Medical School, Boston; pRK5-HA-Ubiquitin-WT (Addgene plasmid no. 17608) was obtained from Ted Dawson, Johns Hopkins University, School of Medicine, Baltimore.

Zella D., Curreli S., Benedetti F., Krishnan S., Cocchi F., Latinovic O.S., Denaro F., Romerio F., Djavani M., Charurat M.E., Bryant J.L., Tettelin H, & Gallo R.C. (2018). Mycoplasma promotes malignant transformation in vivo, and its DnaK, a bacterial chaperone protein, has broad oncogenic properties. Proceedings of the National Academy of Sciences of the United States of America, 115(51), E12005-E12014.

+ Open protocol

+ Expand

Preparation of Arginine-Functionalized Poly(ε-caprolactone) Nanoparticles

Check if the same lab product or an alternative is used in the 5 most similar protocols

For the preparation of the solutions, ultrapure-grade water purified with a Milli-Q system from Millipore (Billerica, MA, USA) was used. L-Arginine and epichlorohydrin were obtained from Biochem Chemopharma (Cosne-Cours-sur-Loire, France). Sodium chloride (NaCl) and tris(hydroxymethyl) aminomethane (Tris) were obtained from Scharlab (Barcelona, Spain), sodium hydroxide (NaOH; pellets) was obtained from Fisher Chemical (Geel, Belgium), and sodium hydrogen carbonate (NaHCO₃) was obtained from Panreac Química SLU (Barcelona, Spain). Moreover, poly (ε-caprolactone) with Mw 50.000 (CAPA 6500) in the form of 3 mm pellets was obtained from Perstorp Caprolactones (Cheshire, UK). The p53-encoding plasmid (pcDNA3–FLAG–p53) used in this work was acquired from Addgene (Cambridge, MA, USA—plasmid 10838) [1 (link),2 (link),3 (link)]. The NZYMaxiprep kit and the DNA ladder (Ladder III) were purchased from NZYTech (Lisbon, Portugal).

Valente J.F., Carreira T.S., Dias J.R., Sousa F, & Alves N. (2022). Arginine-Modified 3D-Printed Chromatographic Supports. Pharmaceutics, 14(11), 2266.

+ Open protocol

+ Expand

RNA Sequencing of p53-Overexpressing Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

Three SEQ libraries (TruSeq^® Stranded mRNA Library Prep) each of vehicle control (pcDNA4/HisMax, Invitrogen) and FLAG-p53 (pcDNA3 FLAG-p53, Addgene) re-expressing cells (electroporation) were prepared from purified mRNAs of HepG2 p53KO cells under untreated (GM) or treated (SM) conditions for a total of 4 × 3 (12) libraries. Raw sequencing data was generated on an Illumina NextSeq 550 and mapped to the human genome (hg18) using STAR alignment [82 (link)]. Differentially expressed genes were found using DEseq2 package in R, data were transformed (VST), Wald-Test performed on individual genes, and Benjamini–Hochberg corrected for multiple testing. Genes with an adjusted p-value ≤ 0.05 were used for further analysis.

Galhuber M., Michenthaler H., Heininger C., Reinisch I., Nössing C., Krstic J., Kupper N., Moyschewitz E., Auer M., Heitzer E., Ulz P., Birner-Gruenberger R., Liesinger L., Lenihan-Geels G.N., Oster M., Spreitzer E., Zenezini Chiozzi R., Schulz T.J., Schupp M., Madl T., Heck A.J, & Prokesch A. (2022). Complementary omics strategies to dissect p53 signaling networks under nutrient stress. Cellular and Molecular Life Sciences, 79(6), 326.

+ Open protocol

+ Expand

Quantifying Biomolecule Binding Capacity

Check if the same lab product or an alternative is used in the 5 most similar protocols

The DBC of MP-SilPrMImCl was addressed toward BSA, pcDNA3-FLAG-p53 (Addgene, plasmid 10,838) and recombinant E. coli DH5α small RNA (see sample preparation of small RNA and plasmid DNA), being representative of three major classes of biomolecules present in lysate media. The typical chromatographic process for the determination of DBC was performed with a flow-rate of 1 mL/min and includes: (i) MP-SilPrMImCl equilibrium with 10 mM Tris-HCl, pH 8 to allow the binding of small RNA; (ii) overloading of 50 μg/mL small RNA solution; (iii) elution of the retained small RNA through an increase of the NaCl concentration to 1 M (in 10 mM Tris-HCl, pH 8) using a stepwise gradient. MP-SilPrMImCl DBC for BSA and pcDNA3-FLAG-p53 were determined using 2.0 mg/mL and 50.0 μg/mL aqueous solutions, respectively. The DBC values (mg/mL) are represented at 10 and 50 of the breakthrough, and correspond to 10% and 50% of maximum capacity.

Neves M.C., Pereira P., Pedro A.Q., Martins J.C., Trindade T., Queiroz J.A., Freire M.G, & Sousa F. (2020). Improved ionic-liquid-functionalized macroporous supports able to purify nucleic acids in one step. Materials Today Bio, 8, 100086.

+ Open protocol

+ Expand

Plasmid Construction and Antibody Characterization

Check if the same lab product or an alternative is used in the 5 most similar protocols

pCMV-myc3-HDM2 (Addgene Plasmid #20935) was a gift from Yue Xiong, pcDNA3 flag p53 (Addgene plasmid # 10838) was a gift from Thomas Roberts, HA-tagged ubiquitin plasmids (WT, K48, and K63) were gift from Ted Dawson [16 (link)]. LentiCRISPRv2 was a gift from Feng Zhang (Addgene plasmid # 52961), and sgRNA specificly targeting human MYL6B (6Bsg1: ACTTTGGAGAGATCGACTGG; 6Bsg2: TTATACTTTAGAGTTCAAGG and 6Bsg3: TTCCCGTGAAGAAACCAGCA) were cloned into LentiCRISPRv2 following provider’s guide. Myc-DDK-tagged Human MYL6B ORF sequence was cloned into pCMV6 (OriGene). 3FLAG-tagged MYL6B ORF sequence was cloned into pcDNA3. Rabbit polyclone antibodies anti-p53, anti-Bax, anti-MYL6B, anti-MDM2 and mouse monoclone antibody anti-GAPDH were from Proteintech Inc. Rabbit polyclone antibody anti-ubiquitin were from Dako. Mouse monoclone anti-FLAG M2, anti-FLAG M2 Affinity Agarose Gel, and anti-c-Myc Affinity Agarose Gel was from Sigma-Aldrich.

Xie X., Wang X., Liao W., Fei R., Wu N., Cong X., Chen Q., Wei L., Wang Y, & Chen H. (2018). MYL6B, a myosin light chain, promotes MDM2-mediated p53 degradation and drives HCC development. Journal of Experimental & Clinical Cancer Research : CR, 37, 28.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!