Amv first strand cdna synthesis kit

Manufactured by Sangon

Sourced in China

The AMV First Strand cDNA Synthesis Kit is a laboratory tool used for the reverse transcription of RNA into complementary DNA (cDNA). The kit contains the necessary reagents, including the Avian Myeloblastosis Virus (AMV) reverse transcriptase enzyme, for the conversion of RNA into single-stranded cDNA molecules.

Automatically generated - may contain errors

Lab products found in correlation

23 protocols using amv first strand cdna synthesis kit

Visualizing BoORP3a Subcellular Localization

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted using RNAiso reagent (TaKaRa Shuzo Co. Ltd, Japan) according to the manufacturer’s instructions. RNA integrity and purity were assessed on 1% (w/v) agarose gels with a NanoDrop 8000 spectrophotometer (Thermo Scientific, USA). First-strand cDNA synthesis was conducted with the AMV First Strand cDNA Synthesis Kit (Shanghai Sangon Biotechnology Co., Ltd).
The pCAMBIA1302-BoORP3a-eGFP expression vector was constructed using the subcellular localization primers to amplify the BoORP3a coding sequence (Table S1, see online supplementary material). The resulting plasmid was transformed into Agrobacterium (Agrobacterium tumefaciens) strain GV3101. Agrobacteria harboring the 35S:eGFP or 35S:BoORP3a-eGFP plasmids were then infiltrated into the leaves of 30-day-old Nicotiana benthamiana plants. An endoplasmic reticulum-specific marker (ER-rk) was co-infiltrated with the BoORP3a-eGFP or eGFP constructs. N. benthamiana plants were then cultivated in the dark for 18 h, followed by return to light for 24 h. GFP fluorescence was observed at an excitation wavelength of 488 nm and an emission wavelength of 510 nm with a confocal microscope (Leica TCS SP82400301, Germany) as described previously [43 (link)].

Zhang S., Zhou F., Liu Z., Feng X., Li Y, & Zhu P. (2022). Inactivation of BoORP3a, an oxysterol-binding protein, causes a low wax phenotype in ornamental kale. Horticulture Research, 9, uhac219.

+ Open protocol

+ Expand

Quantifying ε-PL Biosynthesis Pathway Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Mycelia of ε-PL hyper-yielding strain WG-608 and the original strain M-Z18 were sampled at 96 h during the fed-batch fermentation, then 10 DEGs (sdhA, pls, metH, gltA, aceA, aspB, typB, glk, ppc, ppdk) associated with ε-PL biosynthesis pathway were analyzed by qRT-PCR to ensure the reliability of RNA-sequencing. Total RNA obtained from same individuals was extracted using HiScript III RT SuperMix for qPCR(+gDNA wiper) (Vazyme, China). cDNA was synthesized using AMV First Strand cDNA Synthesis Kit (Sangon Biotech, China) based on the kit instructions, while the specific primers for target genes were designed using Beacon Designer 7 software and listed in Supplementary Table S2. The qRT-PCR experiment was performed as described by Du et al. (2022) (link) using StepOne Real-Time PCR (Applied Biosystems, United States) and SYBRR Premix Ex TaqTM (Takara, Japan) with the following procedures: pre-incubation at 95°C for 30 s; 40 cycles at 95°C for 5 s, 60°C for 30 s, and cooling at 50°C for 30 s. The 20 μL reaction system was composed of 10.0 μL 2 × ChamQ Universal SYBR qPCR Master Mix, 2 μL DNA/cDNA template, 0.4 μL forward and reverse primers (10 μM), and 7.2 μL dH₂O.The housekeeping gene hrdB, encoding RNA polymerase principal sigma factor, was selected as the reference gene for normalization.

Wang L., Yang H., Wu M., Zhang J., Zhang H., Mao Z, & Chen X. (2023). Integrative transcriptome and proteome revealed high-yielding mechanisms of epsilon-poly-L-lysine by Streptomyces albulus. Frontiers in Microbiology, 14, 1123050.

+ Open protocol

+ Expand

Quantification of BDNF Expression in Rat Cortex

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

The peri-infarct regions of cortex of four rats in each group were collected on day 3 and day 7 of HT treatment. Total RNA was extracted from tissues by Trizol Reagent (Invitrogen Life Technologies). Total RNA was reversely transcribed to cDNA using the AMV First Strand cDNA Synthesis Kit (Sangon Biotech, Shanghai, China). PCR amplification was performed in 20 μL containing 1 μL of each primer and 10 μL SybrGreen RT-PCR Master Mix (Toyobo, Osaka, Japan). The amplification procedure was performed at 95 °C for 3 min followed by 40 cycles of amplification reactions at 95 °C for 15 s and 60 °C for 40 s. The primers used included BDNF (185 bp): forward, 5′ TGGGGTTAGGAGAAGTCAAGC 3′, reverse, 5′ TGTTTCACCCTTTCCACTCCT 3′; β-actin (163 bp): forward, 5′ CGTAAAGACCTCTATGCCAACA 3′, reverse, 5′ AGCCACCAATCCACACAGAG 3′. β-Actin cDNA was used as a control. Relative expression between a given sample and a reference sample was calculated using the 2^–ΔΔCt method [22 (link)].

Duan S., Wang T., Zhang J., Li M., Lu C., Wang L., Zou Y, & Fu F. (2017). Huatuo Zaizao pill promotes functional recovery and neurogenesis after cerebral ischemia-reperfusion in rats. BMC Complementary and Alternative Medicine, 17, 19.

+ Open protocol

+ Expand

Genomic DNA and Total RNA Extraction

Check if the same lab product or an alternative is used in the 5 most similar protocols

Genomic DNA was extracted from fresh leaves using the CTAB method [32 (link)]. The integrity of the DNA was assessed using electrophoresis on a 1% (w/v) agarose gel on a gel-imaging system (Syngene, Cambridge, UK). The concentration of DNA was adjusted to 50 ng/μL, as determined using a NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA).
Total RNA was extracted from fresh tissues collected at different growth stages using the EASYspin Plus Complex Plant RNA Kit (Aidlab, Beijing, China). First-strand cDNA was synthesized with the AMV First-Strand cDNA Synthesis Kit (Sangon Biotech, Shanghai, China).

Feng X., Yang X., Zhong M., Li X, & Zhu P. (2022). BoALG10, an α-1,2 glycosyltransferase, plays an essential role in maintaining leaf margin shape in ornamental kale. Horticulture Research, 9, uhac137.

+ Open protocol

+ Expand

Quantitative Real-Time PCR for Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA extractions and quality control experiments were performed as described in the previous section. Reverse transcription was performed using the AMV First Strand cDNA Synthesis Kit (Sangon Biotech), according to the manufacturer's instructions. Primer 5 software was used to select the primers. Quantitative real-time PCR assays were performed with the SYBR Green PCR Master Mix (Applied Biosystems) in a StepOnePlus Real-Time PCR System. Reactions were performed according to the manufacturer's instructions, and three technical replicates were included for each sample. Gene transcription levels was determined according to the 2^−ΔΔCT method, using the 18S rRNA gene as a reference gene for normalizing gene expression levels, as described (Stevenson and Weimer, 2005 (link)). To verify RNA-Seq data, Pearson correlation coefficient values were calculated using Microsoft Excel (Microsoft Corporation, Redmond, WA, USA), and used as an indicator for the degree of correlation for the compared pairs.

Li Z., Chen Y., Liu D., Zhao N., Cheng H., Ren H., Guo T., Niu H., Zhuang W., Wu J, & Ying H. (2015). Involvement of glycolysis/gluconeogenesis and signaling regulatory pathways in Saccharomyces cerevisiae biofilms during fermentation. Frontiers in Microbiology, 6, 139.

+ Open protocol

+ Expand

Quantitative Gene Expression Analysis

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA extractions and quality control experiments were performed as described in the previous section. Reverse transcription was performed using an AMV First Strand cDNA Synthesis Kit (Sangon Biotech) according to standard protocols. Primer 5 software was used to select the primers. The analyzed genes and primers used for analysis are listed in Table 2. Quantitative real-time PCR (qRT-PCR) assays were performed using SYBR Green PCR Master Mix (Applied Biosystems) in a StepOnePlus Real-Time PCR System. Reactions were performed according to manufacturer instructions, and three technical replicates with one negative control were performed for each sample. Gene transcription levels were determined according to the 2^−ΔΔCT method, using 18s rRNA and FBA1 as reference genes for normalizing gene expression levels (Tofalo et al., 2014 (link); Li et al., 2015 (link); Nadai et al., 2015 (link)).

Yang L., Zheng C., Chen Y, & Ying H. (2018). FLO Genes Family and Transcription Factor MIG1 Regulate Saccharomyces cerevisiae Biofilm Formation During Immobilized Fermentation. Frontiers in Microbiology, 9, 1860.

+ Open protocol

+ Expand

Galanin Expression in Rat Sciatic Nerve Injury

Check if the same lab product or an alternative is used in the 5 most similar protocols

Normal rats (n = 3, as a control) and rats with sciatic nerve ligation 10 days after surgery (n = 3) received injection of over dose of 10% trichloroacetaldehyde monohydrate and the brain was removed immediately. The regions of the ACC were dissected on ice and the total RNA was isolated with UNIQ-10 Column Trizol Total RNA Extraction Kit (Sangon Biotech, Shanghai, China) following the instruction. Total RNA was firstly reverse-transcribed using AMV First Strand cDNA Synthesis Kit (Sangon Biotech, Shanghai, China), and the RT-PCRs were performed using StepOne™ Real-Time PCR System and software (Thermo Fisher Scientific, USA). Sequences of primers for the experiments were rat galanin: sense 5′-CACATGCCATTGACAACCAC-3′ and antisense 5′-AACTCCATTATAGTGCGGACG-3′; rat galanin receptor 2: sense 5′-GCCGCCATCGGGCTCATCTG-3′ and antisense 5′-GTCGAGGTGCGCTCCATGCT-3′); rat GAPDH: sense 5′-GACCACCCAGCCCAGCAAGG-3′and antisense 5′-TCCCCAGGCCCCTCCTGTTG-3′. The unigene expression levels were calculated with the 2(-delta delta C (T)) method45 (link).

Zhang M.L., Wang H.B., Fu F.H, & Yu L.C. (2017). Involvement of galanin and galanin receptor 2 in nociceptive modulation in anterior cingulate cortex of normal rats and rats with mononeuropathy. Scientific Reports, 7, 45930.

+ Open protocol

+ Expand

RNA Extraction from Microcystis aeruginosa

Check if the same lab product or an alternative is used in the 5 most similar protocols

M. aeruginosa cells were suspended in Trizol lysis buffer (Total RNA Extractor, Sangon Biotech, Shanghai, China) for RNA extraction. Two extractions with chloroform were followed by two extractions with isopropyl alcohol. RNA was then ethanol precipitated using standard methods [50 ] and resuspended in RNase-free water. Contaminating genomic DNA was removed with a Turbo DNA-free kit (Ambion, Carlsbad, CA, USA). Samples were considered DNA free if no bands were visible in an agarose gel after 30 cycles of PCR amplification using 27F and 1522R primers [51 (link)]. RNA was further quantified by NanoDrop spectrophotometer and the quality and concentration for a selection of samples was verified using Agilent 2100 Bioanalyzer. A total amount of 500 ng RNA was used for the real-time reverse transcription quantitative polymerase chain reaction (RT-qPCR). The cDNA was generated using the AMV First Strand cDNA Synthesis Kit (Sangon Biotech, Shanghai, China) following the manufacturer’s protocol. cDNA samples were stored at −20 °C before running RT-qPCR.

Peng G., Lin S., Fan Z, & Wang X. (2017). Transcriptional and Physiological Responses to Nutrient Loading on Toxin Formation and Photosynthesis in Microcystis Aeruginosa FACHB-905. Toxins, 9(5), 168.

+ Open protocol

+ Expand

Yield-Related Gene Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

The transcript levels of 11 candidate DEGs of yield-related genes were verified by quantitative real-time PCR (qRT-PCR). Total RNA was treated with DNase, and first-strand cDNA was generated using an AMV First Strand cDNA Synthesis Kit (Sangon, Shanghai, China). SYBR-based qRT-PCRs (SYBR Green I, ABI, Bel Air, MD, United States) were performed on a LightCycler 480 system (Roche, Basel, Switzerland) using the following reaction conditions: 95°C for 3 min followed by 40 cycles of 95°C for 15 s and 60°C for 40 s. The actin gene was used as the internal standard. Three independent biological and technological replicates were performed. The relative transcription level was calculated according to the 2^–ΔΔCt method with actin reference genes as a control. Primers are available in Supplementary Table 2.

Xiong H., Wang R., Jia X., Sun H, & Duan R. (2022). Transcriptomic analysis of rapeseed (Brassica napus. L.) seed development in Xiangride, Qinghai Plateau, reveals how its special eco-environment results in high yield in high-altitude areas. Frontiers in Plant Science, 13, 927418.

+ Open protocol

+ Expand

RNA Extraction and RT-qPCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from the frozen tissue specimens using Total RNA Extractor (Sangon Biotech Co., Ltd., Shanghai, China). The RNA was reverse transcribed into cDNA using an AMV First Strand cDNA Synthesis kit (Sangon Biotech Co., Ltd.). The mixture of total RNA, random Primer p(dN)₆ and rnase-free ddH₂O was bathed at 70°C for 5 min, and then placed in an 0°C ice bath for 10 sec. Then 5X reaction buffer, dNTP mix (10 mmol/l), Rnase inhibitor (20 U/l) and AMV reverse transcriptase (10 U/l) were added into the mixture at 37°C for 5 min, 42°C for 60 min and 70°C for 10 min in order to synthesize the cDNA. RT-qPCR analysis was performed in a Light Cycler 480 (Roche Diagnostics, Basel, Switzerland) using SG Fast qPCR Master mix (BBI Solutions, Cardiff, UK). The GAPDH cDNA was employed as an internal control for each sample. ASPP expression was normalized using the 2^−∆∆Cq method (21 (link)). The 40 cycles thermocycling conditions were: 95°C for 7 sec, 55°C for 10 sec and 72°C for 15 sec. All the primers used in RT-qPCR are as follows: GAPDH forward, 5′-TGGGTGTGAACCATGAGAAGT-3′ and reverse, 5′-TGAGTCCTTCCACGATACCAA-3′; ASPP2 forward, 5′-GTGCTGCCTCATGTAACAACG-3′ and reverse, 5′-GTAGCCTTCCTCCATTTCCTC-3′; ASPP1 forward, 5′-CAGTGTATGGTAAGCCCGTTTT-3′ and reverse, 5′-TGGACAGTGACCCGTGAAGA-3′; and iASPP forward, 5′-TGCCTACCACCATCATCACAT-3′ and reverse, 5′-GACCAATGTTTCCCACCCA-3.

Yin L., Lin Y., Wang X., Su Y., Hu H., Li C., Wang L, & Jiang Y. (2018). The family of apoptosis-stimulating proteins of p53 is dysregulated in colorectal cancer patients. Oncology Letters, 15(5), 6409-6417.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!