Vinculin

Manufactured by Santa Cruz Biotechnology

Sourced in United States, United Kingdom, Germany

Vinculin is a cytoskeletal protein that plays a crucial role in cell-cell and cell-matrix adhesion. It is involved in the regulation of actin filament organization and the formation of focal adhesions.

Automatically generated - may contain errors

Lab products found in correlation

138 protocols using vinculin

Protein Expression Analysis in Lung Tissue

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Detection of MIF, angiopoietin (Ang)1, Ang 2, tyrosine kinase with immunoglobulin and epidermal growth factor homology domains receptor 2 (Tie2), Vascular Endothelial Growth Factor-A (VEGF-A), interleukin (IL)-6, IL-1β, YWHAZ and FOXO3 was performed using vinculin and β-actin as loading controls from lung tissue and MLEC lysates using Western blot as previously described [25 (link)].
The primary antibodies used were MIF (Abcam, Cambridge, UK, 1:400), vinculin (Santa-Cruz Biotechnology, Dallas, TX; 1:10,000), β-actin (Cell Signaling Technology, Danvers, MA), Ang1, (Sigma-Aldrich, St. Louis, MO, 1:500), Ang2 (Sigma-Aldrich, St. Louis, MO, 1:500), Tie2 (Santa-Cruz Biotechnology, Dallas, TX; 1:200), VEGF-A (Abcam, Cambridge, UK, 1:200), IL-6 (Santa-Cruz Biotechnology, Dallas, TX; 1:500), IL-1β (Cell Signaling Technology, Danvers, MA), FOXO3 (Cell Signaling Technology, Danvers, MA; 1:1000), YWHAZ, (Santa-Cruz Biotechnology, Dallas, TX; 1:800).
ImageJ software was used to analyze expression of target proteins relative to either vinculin or β-actin loading controls.

Gilfillan M., Das P., Shah D., Alam M.A, & Bhandari V. (2020). Inhibition of microRNA-451 is associated with increased expression of Macrophage Migration Inhibitory Factor and mitgation of the cardio-pulmonary phenotype in a murine model of Bronchopulmonary Dysplasia. Respiratory Research, 21, 92.

+ Open protocol

+ Expand

Protein Expression Analysis in Cell and Tumor Lysates

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Cell and tumor lysates were prepared in NP-40 lysis buffer with protease inhibitor cocktail or Cell Lysis Buffer (Cell signaling, Danvers, MA, USA) respectively. Analysis of lysates was carried out as previously described [7 (link)]. Primary antibodies used were: γH2AX (Cell Signaling), RAD51 (abcam, Cambridge, MA, USA), Ku80 (Bethyl Laboratories, Montgomery, TX, USA), BRD4 (Cell Signaling), BRD2 (Cell Signaling), vinculin (Santa Cruz Biotech, Dallas, TX, USA), GAPDH (Cell Signaling), β-actin (Cell Signaling), α-Tubulin (Cell Signaling), p21 (Cell Signaling), Cleaved PARP (Cell Signaling). Blots were quantitated using ImageStudio Lite (LI-COR Biosciences, Lincoln, NE, USA).

Miller A.L., Fehling S.C., Garcia P.L., Gamblin T.L., Council L.N., van Waardenburg R.C., Yang E.S., Bradner J.E, & Yoon K.J. (2019). The BET inhibitor JQ1 attenuates double-strand break repair and sensitizes models of pancreatic ductal adenocarcinoma to PARP inhibitors. EBioMedicine, 44, 419-430.

+ Open protocol

+ Expand

Analyzing Apoptosis Signaling Pathways

Check if the same lab product or an alternative is used in the 5 most similar protocols

Antibodies against PARP, Caspases, Bax, mTOR (Ser2448), mTOR (Ser2481), Pan Akt, p70S6K (Thr-389), 4E-BP1 (Thr37/46), Akt (Ser473), Pan Akt, LC3. Beclin 1 and p62 were purchased from Cell Signaling (Beverly, MA, USA). Vinculin and β- actin were purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA). Chemicals for extraction, chromatography and LC-MS were purchased from Merck and other chemicals were purchased from Sigma.

Dan V.M., Muralikrishnan B., Sanawar R., J. S. V., Burkul B.B., Srinivas K.P., Lekshmi A., Pradeep N.S., Dastager S.G., Santhakumari B., Santhoshkumar T.R., Kumar R.A, & Pillai M.R. (2018). Streptomyces sp metabolite(s) promotes Bax mediated intrinsic apoptosis and autophagy involving inhibition of mTOR pathway in cervical cancer cell lines. Scientific Reports, 8, 2810.

+ Open protocol

+ Expand

Western Blot Analysis of Apoptotic Signaling

Check if the same lab product or an alternative is used in the 5 most similar protocols

Lysates were centrifuged, supernatants were collected, and protein concentration was determined using a DC Protein Assay (Bio-Rad Laboratories, Hercules, CA). Samples were electrophoresed using 4–15% gradient polyacrylamide gels (Bio-Rad) and then transferred to nitrocellulose membranes (Bio-Rad). Membranes were blocked, rinsed and incubated with primary antibodies against unprenylated Rap1A (Santa Cruz Biotechnology, Inc., Santa Cruz, CA), p-P38, total P38, p-Pak1, total Pak1 (Cell Signaling Technology, Inc., Danvers, MA), cleaved PARP-1 (Cell Signaling) and cleaved caspase-3 (eBioscience). After overnight incubation at 4°C, membranes were washed and incubated with their corresponding secondary antibody conjugated with horseradish peroxidase (HRP). Protein bands were detected with an enhanced chemiluminescence detection kit (GE Healthcare, Piscataway, NJ). β-Actin (Sigma Aldrich) and vinculin (Santa Cruz) were used as loading controls.

Gonzalez-Villasana V., Fuentes-Mattei E., Ivan C., Dalton H.J., Rodriguez-Aguayo C., Fernandez-de Thomas R.J., Aslan B., Monroig P.D., Velazquez-Torres G., Previs R.A., Pradeep S., Kahraman N., Wang H., Kanlikilicer P., Ozpolat B., Calin G., Sood A.K, & Lopez-Berestein G. (2015). Rac1/Pak1/p38/MMP-2 axis regulates angiogenesis in ovarian cancer. Clinical cancer research : an official journal of the American Association for Cancer Research, 21(9), 2127-2137.

+ Open protocol

+ Expand

Molecular Mechanisms of Ferroptosis Regulation

Check if the same lab product or an alternative is used in the 5 most similar protocols

Erastin was obtained from the Duke University Small Molecule Synthesis Facility. The following antibodies, their catalog numbers, sources and diltuionswere indicated below: YAP/TAZ (#8418, Cell Signaling Technology, 1:1000), βa-tubulin (#86298, Cell Signaling Technology, 1:2000), vinculin (sc-73614, Santa Cruz, 1:2000), V5 tag (#13202, Cell Signaling Technology, 1:2000), H3 (#4499, Cell Signaling Technology, 1:2000), GAPDH (sc-25778, Santa Cruz, 1:2000), ANGPTL4 (#40–9800, ThermoFisher Scientific, 1:1000), NOX2 (sc-130543, Santa Cruz, 1:1000), anti-rabbit IgG, horseradish peroxidase (HRP)-linked antibody (#7074, Cell Signaling Technology, 1:2000–1:4000) and anti-mouse IgG, HRP-linked Antibody (#7072, Cell Signaling Technology, 1:2000–1:4000). Plasmids were obtained from Addgene (TAZS89A #52084; ANGPTL4-V5 #102446). The NOX2 inhibitor, gp91 ds-tat, was purchased from Eurogentec (cat #: AS-63818) and recombinant human ANGPTL4 protein was purchased from Novus Biologicals (4487-AN). VAS2870 (Calbiochem-492000), GKT136901 (Calbiochem-534032), Z-VAD-FMK (SML0583), ferrostatin-1 (SML0583) and liproxstatin-1 (SML1414) were purchased from Sigma.

Yang W.H., Huang Z., Wu J., Ding C.K., Murphy S.K, & Chi J.T. (2019). A TAZ-ANGPTL4-NOX2 axis regulates ferroptotic cell death and chemoresistance in epithelial ovarian cancer. Molecular cancer research : MCR, 18(1), 79-90.

+ Open protocol

+ Expand

BRCA2 Knockout and Gene Silencing

Check if the same lab product or an alternative is used in the 5 most similar protocols

Human HeLa, HCC1395, 293T and U2OS cells were grown in Dulbecco’s modified Eagle’s medium (DMEM), while SH-SY5Y were grown in DMEM/F12 (1:1). Media was supplemented with 10% fetal calf serum. For BRCA2 gene knockout, the commercially available BRCA2 CRISPR/Cas9 KO plasmid was used (Santa Cruz Biotechnology sc-400700). Transfected cells were FACS-sorted into 96-well plates using a BD FACSAria II instrument. Resulting colonies were screened by western blot. Cell extracts, chromatin fractionation and western blot experiments were performed as previously described (29–31 (link)). Antibodies used for Western blot were: BRCA2 (Bethyl A303-434A), GAPDH (Santa Cruz Biotechnology sc-47724), RAD51 (Santa Cruz Biotechnology sc-8349), Vinculin (Santa Cruz Biotechnology sc-73614), RAD52 (Santa Cruz Biotechnology sc-365341). For gene knockdown, cells were transfected with Stealth siRNA (Life Tech) using Lipofectamine RNAiMAX reagent. For co-depletion experiments, control (non-targeting) siRNA was added to the targeting siRNA in the single knockdown samples to equalize total siRNA levels. The siRNA targeting sequences used were: E2F7 #1: GGACGATGCATTTACAGATTCTCTA; E2F7 #2: GACTATGGGTAACAGGGCATCTATA; E2F7 #3: AAACAAAGGTACGACGCCTCTATGA (used for E2F7 knockdown unless otherwise mentioned); BRCA2: GAGAGGCCTGTAAAGACCTTGAATT; RAD51: CCATACTGTGGAGGCTGTTGCCTAT; RAD52: GGCCAATGAGATGTTTGGTTACAAT.

Clements K.E., Thakar T., Nicolae C.M., Liang X., Wang H.G, & Moldovan G.L. (2018). Loss of E2F7 confers resistance to poly-ADP-ribose polymerase (PARP) inhibitors in BRCA2-deficient cells. Nucleic Acids Research, 46(17), 8898-8907.

+ Open protocol

+ Expand

Protein Extraction and Analysis Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

MV4;11 and 293T cells were lysed with RIPA buffer supplemented with halt protease inhibitor cocktail (Thermo Fisher Scientific) and 0.1% benzonase (Novagen) on ice for 60 minutes. Lysates were clarified by centrifugation at 20,000 xg for 10 minutes at 4 ºC. NIH/3T3 and 293FT cells were lysed with RIPA buffer supplemented with cOmplete protease inhibitors (Roche) and PhosSTOP phosphatase inhibitors (Roche) on ice for 60 minutes. Lysates were clarified by centrifugation at 20,000 xg for 10 minutes at 4 ºC. Protein concentration was determined by a BCA assay (Pierce), and all samples were run with equal total protein content. The following antibodies were used in this study: HA (Cell Signaling, #3724 and #2367), BRD4 long isoform (Bethyl labs, #A301-985A), BRD4 short isoform (Abcam, #ab128874), BRD3 (Abcam, #ab56342), BRD2 (Bethyl labs, #A302–582A), FKBP12 (Abcam, #ab24373), vinculin (Santa Cruz, #Sc-25336), GAPDH (Millipore, #MAB374), phospho-AKT S473 (Cell Signaling, #4060), AKT (Cell Signaling, #2920), phospho-MEK1/2 S221 (Cell Signaling, #2338), MEK1/2 (Cell Signaling, #4694), phospho-ERK1/2 T202/Y204 (Cell Signaling, #4370), ERK1/2 (Cell Signaling, #4696), phospho-Pol II S2 (Millipore, #04-1571-1), and Pol II (Santa Cruz, #Sc-899). Imaging was performed by detection of fluorescently labelled infrared secondary antibodies (IRDye) on the Odyssey CLx Imager (LI-COR).

Nabet B., Roberts J.M., Buckley D.L., Paulk J., Dastjerdi S., Yang A., Leggett A.L., Erb M.A., Lawlor M.A., Souza A., Scott T.G., Vittori S., Perry J.A., Qi J., Winter G.E., Wong K.K., Gray N.S, & Bradner J.E. (2018). The dTAG system for immediate and target-specific protein degradation. Nature chemical biology, 14(5), 431-441.

+ Open protocol

+ Expand

Western Blot Analysis of Mitochondrial Dynamics

Check if the same lab product or an alternative is used in the 5 most similar protocols

Western blot analysis was conducted as reported by Pacifici et al. (13 (link)). Briefly, cells were lysed in ice-cold buffer and then centrifuged. Supernatants were collected, and the protein concentration was determined using Bradford assay (Bio-Rad Laboratories, Milan, Italy). 50 µg of protein lysates was loaded on pre-cast 4%–12% gels (Thermo Scientific, Waltham, MA, USA), separated by SDS-PAGE, and transferred to nitrocellulose membranes using Trans-Blot Turbo™ Transfer System (Bio-Rad Laboratories, Milan, Italy). Then, antigen–antibody complexes were detected with enhanced chemiluminescence (ECL) reagent (GE Healthcare, Little Chalfont, UK) followed by exposure to ChemiDoc™ Touch Imaging System (Bio-Rad Laboratories, Milan, Italy). Bands were quantified using Image Lab™ Software (Bio-Rad Laboratories, Milan, Italy).
The primary antibodies used were Fis1 (sc-98900), Drp1 (sc-32898), Mfn1 (sc-50330), Mfn2 (sc-515647), Opa1 (sc-393296), vinculin (sc-73614), NOXA (sc-30209) (all provided by Santa Cruz Biotechnology, Santa Cruz, CA, USA), actin (3700S), caspase (9662S), PARP-1 (9542S), and LC-3 (2775S) (Cell Signaling Technology, Danvers, MA, USA).

Pacifici F., Della-Morte D., Capuani B., Coppola A., Scioli M.G., Donadel G., Andreadi A., Ciccosanti F., Fimia G.M., Bellia A., Orlandi A, & Lauro D. (2022). Peroxiredoxin 6 Modulates Insulin Secretion and Beta Cell Death via a Mitochondrial Dynamic Network. Frontiers in Endocrinology, 13, 842575.

+ Open protocol

+ Expand

MGL Expression Vector Generation

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

The phospho-ERK1/2 (Thr202/Tyr204), ERK1/2, phospho-AKT (Ser473), AKT, phospho-EGFR (Tyr1068) phosphor-mTOR (Ser2248) antibodies were from Cell Signaling (Danvers, MA); EGFR antibody was from Abcam (Cambridge, MA). MGL antibody was generated in our laboratory as previously described^{6 (link)}. The β-actin and α-tubulin antibodies were from Sigma (St. Louis, MO). GAPDH, vinculin, TNF-α and COX-2 antibodies were from Santa Cruz Biotechnologies (Dallas, TX). pDsRedN1-MGL vector (MGL-RFP) has been previously described^{6 (link)}. For pSRα-HA-S-tagged MGL expression vector, complete human MGL ORF was subcloned into mammalian pSRα-HA-S vector (contains HA and S tags) and DNA sequencing was performed to confirm the integrity of MGL sequence.

Liu R., Wang X., Curtiss C., Landas S., Rong R., Sheikh M.S, & Huang Y. (2018). Monoglyceride lipase gene knockout in mice leads to increased incidence of lung adenocarcinoma. Cell Death & Disease, 9(2), 36.

+ Open protocol

+ Expand

Western Blot Analysis of Protein Targets

Check if the same lab product or an alternative is used in the 5 most similar protocols

Cells were washed twice with ice-cold phosphate-buffered saline (PBS) and ruptured with RIPA buffer (Pierce, Rockford, IL) containing 5 mM EDTA, PMSF, cocktail proteinase inhibitors, and phosphatase inhibitor cocktail. Cell extracts were centrifuged at 12000 × g for 15 min and the supernatants were then collected. Cell lysates were resolved by SDS-PAGE and transferred onto PVDF membranes which were blocked with 5% non-fat milk (Bio-Rad) in Tris-buffered saline containing 0.1% Tween 20 for 1 hour and incubated sequentially with primary and secondary antibodies and detected by immunoblotting with the Pierce ECL Western Blotting Substrate (Thermo Fisher Scientific) or Amersham ECL Prime Western Blotting Detection Reagent (GE Healthcare). Antibodies used for Western blotting were as follows: ALKBH5 (ab195377, abcam), ALKBH5 (HPA007196, Sigma-Aldrich), TACC3 (sc-376883, Santa Cruz Biotechnology), Flag (F3165, Sigma-Aldrich), c-Myc (9402S, Cell Signaling Technology), P21 (2947S, Cell Signaling Technology) GAPDH (sc-47724, Santa Cruz Biotechnology), β-Actin (3700, Cell Signaling Technology), Vinculin (sc-25336, Santa Cruz Biotechnology). GAPDH or β-Actin or Vinculin was used as a loading control.

Shen C., Sheng Y., Zhu A., Robinson S., Jiang X., Dong L., Chen H., Su R., Yin Z., Li W., Deng X., Chen Y., Hu Y.C., Weng H., Huang H., Prince E., Cogle C.R., Sun M., Zhang B., Chen C.W., Marcucci G., He C., Qian Z, & Chen J. (2020). M6A demethylase ALKBH5 selectively promotes tumorigenesis and cancer stem cell self-renewal in acute myeloid leukemia. Cell stem cell, 27(1), 64-80.e9.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!