The promoter region of the gene DgDEF1 was amplified from adaptor-ligated genomic libraries by genome walking using the GenomeWalkerTM Universal Kit (TakaraBio, Mountain View, CA, USA). Genomic DNA from D. glomerata leaves was isolated according to Ribeiro et al. [46 (link)]. Per library, 2.5 μg of the DNA were digested, purified and ligated to GenomeWalkerTM Adaptors as described by the manufacturer (TakaraBio). Restriction enzymes EcoRV, ScaI, DraI, PvuII and StuI were used for preparation of the genomic libraries DL1, DL2, DL3, DL4 and DL5. Gene-specific primers used for primary and secondary genome walking PCRs are listed in S1 Table . PCR amplification was conducted according to the GenomeWalkerTM protocol (TakaraBio), except for one modification: the denaturation step was carried out at 94°C for 15 s. The promoter region of DgDEF1 was PCR amplified from DL1 with the primers proDgDEF1-for and proDgDEF1-rev (S1 Table ). All PCR products were cloned in pJET1.2 (ThermoFisher) and subsequently sequenced (Eurofins) using the primers pJET1.2-for and pJET1.2-rev ThermoFisher) or gene-specific primers designed for sequencing (S1 Table ).
Pjet1
Manufactured by Thermo Fisher Scientific
Sourced in United States, Germany, Canada, Lithuania
The PJET1.2 is a compact, high-performance pipette from Thermo Fisher Scientific. It is designed for accurate and precise liquid handling in a variety of laboratory applications. The PJET1.2 offers a volume range of 0.1 to 1200 μL and features an ergonomic design for comfortable and efficient use.
Automatically generated - may contain errors
Lab products found in correlation
Phusion high fidelity dna polymerase, by Thermo Fisher Scientific (4 mentions)
Dnase 1, by Thermo Fisher Scientific (4 mentions)
Phusion dna polymerase, by Thermo Fisher Scientific (3 mentions)
Pdrive, by Qiagen (3 mentions)
Phusion polymerase, by Thermo Fisher Scientific (3 mentions)
Abi prism 7900ht sequence detection system, by Thermo Fisher Scientific (3 mentions)
Gel doc system, by Bio-Rad (3 mentions)
Gel extraction kit, by Thermo Fisher Scientific (3 mentions)
Maxima h minus first strand cdna synthesis kit, by Thermo Fisher Scientific (3 mentions)
Sybr green pcr master mix, by Thermo Fisher Scientific (2 mentions)
Zero blunt topo vector, by Thermo Fisher Scientific (2 mentions)
Phusion hs 2, by Thermo Fisher Scientific (2 mentions)
T7 and sp6 polymerase, by New England Biolabs (2 mentions)
Dig rna labelling kit, by Roche (2 mentions)
Genejet gel extraction kit, by Thermo Fisher Scientific (2 mentions)
Accuprime pfx dna polymerase, by Thermo Fisher Scientific (2 mentions)
One shot top10 chemically competent e coli, by Thermo Fisher Scientific (2 mentions)
Phusion high fidelity dna polymerase, by New England Biolabs (2 mentions)
Genejet pcr purification, by Thermo Fisher Scientific (2 mentions)
E coli ec100dpir, by Illumina (2 mentions)
127 protocols using pjet1
1
Genome Walking of DgDEF1 Promoter
2
RALF1 and FER Overexpression Protocols
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For RALF1_2FLAG overexpression, the full‐length coding sequence was amplified using the primers RALF1oE_F GGTACCATGGACAAGTCCTTTACTC and RALF1oE_R CTGCAGAACTCCTGCAACGAGCA. The fragment was cloned into pJET1.2 (Thermo Scientific). A correct clone was cut with PstI and XbaI and fused with a PstI‐2FLAG‐stop XbaI fragment. The resulting RALF1_2FLAG was cut with KpnI and XbaI and cloned into pART7 vector (Gleave, 1992 ), using the same enzymes. The resulting 35S:RALF1_2FLAG construct was cut out by NotI and cloned into the binary vector pBART (Stintzi & Browse, 2000 ).
For overexpression of the NtermFER extracellular domain, the coding sequence was amplified with the primers FER_ECD_F CTCGAGATGAAGATCACAGAGGGAC and FER_ECD_R CTGCAGGCCGTCTGAGAAGCACTG, cloned into pJET1.2 (Thermo Scientific). A correct clone was cut with XhoI as well as PstI and cloned into pART7 (Gleave,1992 ) containing a 2FLAG coding sequence with a PstI site at the 5′ end, cut with XhoI and PstI.
For overexpression of the NtermFER extracellular domain, the coding sequence was amplified with the primers FER_ECD_F CTCGAGATGAAGATCACAGAGGGAC and FER_ECD_R CTGCAGGCCGTCTGAGAAGCACTG, cloned into pJET1.2 (Thermo Scientific). A correct clone was cut with XhoI as well as PstI and cloned into pART7 (Gleave,
3
Generation of EZH1 and EED Constructs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For Ezh1α-FLAG-HA, Ezh1β-FLAG-HA, EED500-FLAG-HA and EED441-FLAG-HA, full-length CDS without stop codon were amplified with corresponding primers (Additional file 5 : Table S1) and ligated into pJET1.2 (Thermo Fisher Scientific) vector for Sanger sequencing. Sanger sequencing confirmed inserts were cut with XhoI/NotI and finally ligated into pOZ-C-FH vector.
For Ezh1α-2XT7, Ezh1β-2XT7, Ezh1βS560A-2XT7 and Ezh1βS560D-2XT7, full-length CDS containing stop codon were amplified using indicated primers listed in Appendix Table EV1, then, similar strategy was used to clone inserts into pOZ-C-FH vectors.
For Lenti-HA-Ubi was purchased from Addgene (Plasmid, #74218). For pOZ-HA-Ubi, HA-Ubi was amplified from Lenti-HA-Ubi and cloned into pJET1.2 (Thermo Fisher Scientific) for Sanger sequencing, then finally cloned into pOZ-C-FH vector.
For Ezh1α-2XT7, Ezh1β-2XT7, Ezh1βS560A-2XT7 and Ezh1βS560D-2XT7, full-length CDS containing stop codon were amplified using indicated primers listed in Appendix Table EV1, then, similar strategy was used to clone inserts into pOZ-C-FH vectors.
For Lenti-HA-Ubi was purchased from Addgene (Plasmid, #74218). For pOZ-HA-Ubi, HA-Ubi was amplified from Lenti-HA-Ubi and cloned into pJET1.2 (Thermo Fisher Scientific) for Sanger sequencing, then finally cloned into pOZ-C-FH vector.
4
Cloning of Secreted EYFP Fusion Protein
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Polymerase chain reactions (PCRs)
for cloning purposes were performed with Q5 high-fidelity DNA polymerase
(New England Biolabs, Ipswich, MA, USA) according to the manufacturer’s
instructions. All used primers are listed inTable 1 . First, the cbh1 promotor
and the sequence encoding for the first 18 amino acids of cbh1 were amplified with the primers Pcbh1_fwd_XhoI and
Pcbh1_Q18r_NheI using chromosomal DNA of QM6a Δtmus53 as the template and inserted into an EcoRV-digested pJET1.2 (Thermo
Scientific, part of Thermo Fisher Scientific Inc., Waltham, MA, USA)
yielding pJET-Pcbh1+18. Next, a codon-optimized eyfp was amplified
with the primers Yfp-fwd-XbaI and Yfp-rev-NotI-NsiI using pCD-EYFP58 (link) as the template and then inserted into pRLMex3059 (link) via digestion with Xba and
NsiI. The eyfp:Tcbh2 fragment was released by digestion with XbaI
and HindIII and inserted into an accordingly digested pJET1.2 (Thermo
Scientific). This plasmid was digested with BspEI and XbaI and the cbh1 promoter fragment was inserted after the release from
pJET-Pcbh1+18 via digestion with BspEI and NheI, yielding pCD-SecYFP.
for cloning purposes were performed with Q5 high-fidelity DNA polymerase
(New England Biolabs, Ipswich, MA, USA) according to the manufacturer’s
instructions. All used primers are listed in
and the sequence encoding for the first 18 amino acids of cbh1 were amplified with the primers Pcbh1_fwd_XhoI and
Pcbh1_Q18r_NheI using chromosomal DNA of QM6a Δtmus53 as the template and inserted into an EcoRV-digested pJET1.2 (Thermo
Scientific, part of Thermo Fisher Scientific Inc., Waltham, MA, USA)
yielding pJET-Pcbh1+18. Next, a codon-optimized eyfp was amplified
with the primers Yfp-fwd-XbaI and Yfp-rev-NotI-NsiI using pCD-EYFP58 (link) as the template and then inserted into pRLMex3059 (link) via digestion with Xba and
NsiI. The eyfp:Tcbh2 fragment was released by digestion with XbaI
and HindIII and inserted into an accordingly digested pJET1.2 (Thermo
Scientific). This plasmid was digested with BspEI and XbaI and the cbh1 promoter fragment was inserted after the release from
pJET-Pcbh1+18 via digestion with BspEI and NheI, yielding pCD-SecYFP.
5
Yeast Two-Hybrid Screening of LRX4 and FER
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For the yeast two‐hybrid experiment, the coding sequence of the LRR domain of LRX4 was amplified using the primers y2hs_LRR4_F GGATCCAAGCTCTTGATAACCGGAAG and y2h_LRR4_R CTCGAGCTATCCACAATCCACCGAAGGCCG and cloned into pJET1.2 (Thermo Scientific). A correct clone was cut with BamHI and XhoI and cloned into pGBKT7 cut with BamHI and SalI. The extracellular domain coding sequence of FER (NtermFER) was amplified using the primers Y2H_FER_F CATGAATTCCGTATATGGATCTCCGAT and Y2H_FER_R ATGCCCGGGTCCGCCGTCTGAGAAGCAC and cloned into pJET1.2 (Thermo Scientific). A correct clone was cut with Eco RI and XmaI and cloned into pGADT7 cut with Eco RI and XmaI. Transformation of the yeast strain PJ69‐4A (James et al, 1996 ) was done following standard procedures and quadruple drop‐out medium lacking Leu, Trp, His and Ade were used to screen for positive interactions.
6
Molecular Cloning of YABBY cDNAs from H. selago
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Molecular cloning of YABBY cDNAs from fresh shoot tips of H. selago was performed by PCR amplification. Total RNA was isolated via the method of Chomczynski and Mackey (1995) (link) using TRIzol reagent. First strand cDNA was synthesized using Maxima First Strand cDNA Synthesis Kit (Thermo Scientific, Waltham, MA). Full length H. selago YABBY cDNA was amplified using the gene-specific primers 5′-GAGCGTACTTGCTACAAATCATGTCATCC-3′ and 5′-GGATGAACTTTCTGGTGGAAGGAGTTACA-3′ and 1.25 U of Taq DNA polymerase (Syntol, Moscow, Russia) according to the manufacturer’s instructions. The absence of contaminating DNA was confirmed by direct PCR for ubiquitin (Heidstra etal. 1994 (link)). PCR conditions were: 40 cycles of 95°C for 30 s, 63 °C for 30 s, and 72 °C for 1 min. PCR products were cloned in pJET1.2 (Thermo Scientific) and sequenced. The genomic sequence of YABBY was amplified using H. selago DNA as a template with the same gene-specific primers and 0.4 U of Phusion High-Fidelity DNA Polymerase (Thermo Scientific). DNA was extracted according to Doyle and Doyle (1990) . The PCR protocol was 98 °C for 5 min, followed by 35 cycles of 98 °C for 10 s, 72 °C for 2.5 min. PCR products were cloned in pJET1.2 (Thermo Scientific) and sequenced (GenBank accession MF175244).
7
Synthesis and Transcription of Human rRNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
cDNAs complementary to human rRNA transcribed spacers 5′ETS (1-1952), ITS1 (1-1095), and ITS2 (1-1155) were synthesized based on the GenBank sequence U13369.135 (link) and cloned into pJET1.2 (Thermo Scientific) in the same orientation of T7 promoter according to manufacturer's information. When indicated, in vitro transcribed rRNAs were prepared with TranscriptAid T7 High Yield Transcription Kit according to manufacturer's protocol (Thermo Scientific) using either Xba1-linearized pJET1.2 vectors or T7 promoter containing PCR products as templates (see Supplementary Materials for specific sequences of PCR primers used in the study), and PCR was performed as previously described.56 (link) When indicated, UTP-biotinylated RNAs were in vitro transcribed in the same protocol except in the presence of biotinylated-UTP (Ambion). All Transcribed RNAs were treated with DNase I before extraction by TRIzol® to remove free nucleotides.
8
Cloning hfq UTR Mutant Fragments
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The nucleotide fragment containing a T7 promoter, the upstream region of hfq (bp −177 through 74), and the GG-to-CC mutation in BS1 was commercially synthesized (Eurofins) and blunt-end cloned into pJet1.2 (Thermo Fisher Scientific) to create pJet1.2::hfq UTR BS1mut. To generate the BS2 and BS1/BS2 fragments, primers (Table S2 under “EMSA probes”) containing the GGA-to-CCC mutation in BS2 or CC-to-GG restoration in BS1 were used with inverse PCR of the pJet1.2::hfq UTR BS1mut to generate mutated fragments for labeled probe generation.
9
Constructing Gfp-reporter Fusions in Yersinia
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Promoter fragments, PhmsH (708 bp) PhmsT (315 bp) and PhmsP (378 bp), were PCR-amplified from Yptb-YPIII genomic DNA, using corresponding primer pairs (Supplementary Table 2 ). Respective PCR-fragments were subcloned into a commercial shuttle vector, pJET1.2/blunt (Thermo Scientific) and sequenced using pJET1.2F and pJET1.2R sequencing primers (Supplementary Table 2 ). Sequence-confirmed fragments were lifted from the shuttle vector by SacI-SphI restriction enzyme digestion, subsequently cloned into SacI and SphI restricted destination plasmid, pNQ705-1, which was then transformed into the E. coli SY327λpir. Each promoter fusion, in-frame with Gfp of pNQ705-1 was confirmed by sequence analysis using the CatR2 and GfpR2 primers pair (Supplementary Table 2 ). The sequence-confirmed Gfp-reporter plasmids were transformed into E. coli S17-1λpir (donor) and mobilised by conjugal mating into parental, ∆cpxA and ∆cpxR strains of Yptb. Genome integrated single copies of each Gfp-reporter fusion in recipient Yptb-YPIII strains was confirmed by colony PCR using respective genomic-integration primer pairs (Supplementary Table 2 ).
10
Heterologous Expression of Fungal Enzyme
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All chemicals were reagent-grade or better and purchased from Sigma-Aldrich (Steinheim, Germany) unless otherwise stated. 2,2′-Azino-bis(3-ethylbenzthiazoline-6-sulfonic acid) (ABTS) was obtained from Amresco (Solon, OH, USA). Restriction enzymes, ligase and standards for Agarose gel electrophoresis (GeneRuler DNA Ladder Mix) were obtained from Fermentas (Vilnius, Lithuania) while the Phusion polymerase was from New England BioLabs (Ipswich, UK). SDS-PAGE protein standard (Precision Plus Protein prestained standard) was from BioRad (Herts, UK). The cloning vector pJET 1.2 was purchased from Fermentas and the expression vector pET21a from Novagen (Madison, WI, USA). The expression vectors pPICZB and pPICZαA, E. coli strain BL21 (DE3) and P. pastoris strain X-33 were purchased from Invitrogen (Carlsbad, CA, USA). E. coli NEB 5-alpha was from New England BioLabs. The HisPrep FF 16/10 column was from GE Healthcare Bioscience AB (Uppsala, Sweden). F. oxysporum strain G12 was kindly provided by Gerhard Adam (Department of Applied Genetics and Cell Biology, BOKU Vienna, Austria).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!