PVSRIPO used in this work is from a good-laboratory-practice lot prepared for research purposes only. Briefly, infectious cDNA plasmid (10 (link)) was linearized with MluI, used as template for T7 in vitro transcription (Megascript, Thermo Fisher) to generate full-length vRNA. In vitro transcript RNA was transfected into HeLa R19 cells using DMRIE-C in Opti-MEM (Thermo Fisher) and virus recovered from the transfection procedure was titered by plaque assay (10 (link)). To prepare virus stocks, four 10-cm dishes of HeLa cells at ~90% confluence were infected at an MOI 10 and incubated 16–24 h until complete CPE. Following three freeze thaw cycles, the culture medium was collected, centrifuged at 14,000 × g and the resulting supernatant filtered through 0.1-μM syringe filters (Pall Corp.). Virus suspension was concentrated by centrifugation through a 100-kDa cutoff spin column (Millipore). Viral stocks were titered by plaque assay (10 (link)). CAV21 was propagated/purified using similar procedures (21 (link)).
Dmrie c
Manufactured by Thermo Fisher Scientific
Sourced in United States
DMRIE-C is a cationic lipid formulation designed for transfection of eukaryotic cells. It is suitable for transient transfection of DNA and RNA into a variety of cell types.
Automatically generated - may contain errors
Lab products found in correlation
Lipofectamine 2000, by Thermo Fisher Scientific (4 mentions)
Opti mem, by Thermo Fisher Scientific (3 mentions)
Mmessage mmachine t7 kit, by Thermo Fisher Scientific (3 mentions)
Lumat lb 9507, by Berthold Technologies (2 mentions)
Passive lysis buffer (plb), by Promega (2 mentions)
Prl sv40, by Promega (2 mentions)
Dual luciferase reporter assay system, by Promega (2 mentions)
T7 in vitro transcription kit, by Thermo Fisher Scientific (2 mentions)
Pcr purification kit, by Qiagen (2 mentions)
Lipofectamine 3000, by Thermo Fisher Scientific (2 mentions)
Megascript, by Thermo Fisher Scientific (1 mentions)
Rnase h, by Thermo Fisher Scientific (1 mentions)
Superscript 3, by Thermo Fisher Scientific (1 mentions)
Pcmv script, by Takara Bio (1 mentions)
293t cell, by American Type Culture Collection (1 mentions)
Polarstar multidetection microplate reader, by BMG Labtech (1 mentions)
Polyjet, by SignaGen (1 mentions)
Renilla luciferase, by Promega (1 mentions)
Mmessenger mmachine t7 kit, by Thermo Fisher Scientific (1 mentions)
Hoechest33258, by Beyotime (1 mentions)
31 protocols using dmrie c
1
Detailed PVSRIPO Virus Production Protocol
2
HEK293T Cell mRNA Transfection Assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
HEK293T cells were transfected in a 24 well plate with 0.25 μg/well of in vitro transcribed m7GpppG(AG)10-FF-HCV-Ren or m7GpppG(UC)10FF-HCV-Ren mRNA using DMRIE-C following the manufacturer’s instructions (ThermoFisher, 10459014). One hour later, cells were exposed to the indicated concentrations of compounds for an additional 6 h. Following this, extracts were prepared using passive lysis buffer (PLB, Promega) and luciferase activity measured on a Berthold Lumat LB 9507 luminometer.
3
Cloning and Expression of Mouse Sdk1 Variants
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The mouse Sdk1 (long form) cDNA in pCMVscript (Clontech, Mountain View, CA) was described previously (Yamagata and Sanes, 2008 (link)). A cDNA encoding the short form of mouse Sdk1 was modified from the long form cDNA. Each plasmid was transfected to 293T cells (ATCC, Manassas, VA) with DMRIE-C (Thermo-Fisher, Waltham, MA) as described previously (Yamagata and Sanes, 2012a (link)).
Total RNA from animals or cultured cells was isolated using illustra RNAspin Mini (GE Heathcare Life Sciences, Marlborough, MA), which uses deoxyribonuclease I to remove DNA. cDNA was generated with Superscript III (Thermo-Fisher/Invitrogen) using random or sdk1 specific primers (CTCTATGATGGAAAGGAAGGCTC) for the short form, and treated with RNase H (Thermo-Fisher). Primer sequences and predicted sizes after PCR were as follows (see Figure1 for location of each primer set).
EconoTaq plus green mixture (Lucigen, Middleton, WI) was used for PCR. PCR cycles were 94°C, 2 min; 42 cycles of 94°C, 30 s; 60°C, 30 s; 72°C, 1 min + 2 s extention; 72°C, 7 min, and 4°C.
Other primer sequences were as follows.
Cre: GCATTACCGGTCGATGCAACGAGTGATGAG, GAGTGAACGAACCTGGTCGAAATCAGTGCG
mouse Gapdh: TGAAGGTCGGTGTGAACGGATTTGGC, CATGTAGGCCATGAGGTCCACCAC.
Total RNA from animals or cultured cells was isolated using illustra RNAspin Mini (GE Heathcare Life Sciences, Marlborough, MA), which uses deoxyribonuclease I to remove DNA. cDNA was generated with Superscript III (Thermo-Fisher/Invitrogen) using random or sdk1 specific primers (CTCTATGATGGAAAGGAAGGCTC) for the short form, and treated with RNase H (Thermo-Fisher). Primer sequences and predicted sizes after PCR were as follows (see Figure
EconoTaq plus green mixture (Lucigen, Middleton, WI) was used for PCR. PCR cycles were 94°C, 2 min; 42 cycles of 94°C, 30 s; 60°C, 30 s; 72°C, 1 min + 2 s extention; 72°C, 7 min, and 4°C.
Other primer sequences were as follows.
Cre: GCATTACCGGTCGATGCAACGAGTGATGAG, GAGTGAACGAACCTGGTCGAAATCAGTGCG
mouse Gapdh: TGAAGGTCGGTGTGAACGGATTTGGC, CATGTAGGCCATGAGGTCCACCAC.
4
Profiling miRNA's Effect on Viral Replication
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Huh7.5.1 cells were treated with the mimic control, miR-135a or miR-122 mimic (at 25 nmol/L) for 72 h in 96-well white plates (in 5 replicates), and then transfected with JFH1-RLuc subgenomic replicon RNA (provided by C. Rice of The Rockefeller University, New York, NY) using DMRIE-C (Thermo Fisher Scientific). Cell lysates were collected after 48 h and measured for Renilla luciferase activities per manufacturer’s instructions (Promega) using a POLARstar multidetection microplate reader (BMG Labtech).
5
HEK293T Cell mRNA Transfection Assay
6
CTCF and SMARCA5 Regulation in Myeloid Leukemia
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
MEL cells were cultured as described elsewhere [16] (link) and transfected (DMRIE-C, LifeTech.) with 25 nM siRNA-CTCF or non-silencing control siRNA (L-044693-01, Dharmacon). Stable transgenic Smarca5-shRNA cells were kindly obtained from Prof. Arthur. I. Skoultchi Laboratory. shSmarca5 was activated with 1 µg/mL of doxycycline. 2×106 OCI-M2 cells [15] (link) (DSMZ) were transfected (Amaxa) with 20 pmol siRNA-hSMARCA5 (s16082, Ambion, control: #1-AM4611), or with 0,5 µg pCTCF (Origene) or pBSK+ plasmid negative control. OCI-M2 were treated with 5 µM AZA (3-doses in 72 hrs) in presence of granulocyte colony-stimulating factor (G-CSF) (50 ng/ml) [15] (link).
7
Characterizing Variant Allele Function in B Cells
8
Characterizing Variant Allele Function in B Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
GM11993 and GM12005 B lymphoblast cell lines, mycoplasma-negative, were obtained from Coriell Institute Biorepository. Eight functional outside variant loci (~1–2 kb, Supplementary Table 2 ) were cloned from B lymphoblast cell lines that were heterozygous for the outside variant allele of interest into a luciferase reporter construct (pGL4 from Promega) for which the luciferase gene was driven by the ubiquitous mSox9 promoter. Sanger sequencing was utilized to identify the genotype of the outside variant allele in each clone (Supplementary Fig. 4 ). Two control loci, ~1–2 kb regions with no expected enhancer activity in B-lymphoblasts, were also cloned into the same construct to generate size-matched constructs to control for basal promoter activity. Reporter constructs were transfected into B lymphoblast cell line GM12005 using the transfection reagent DMRIE-C (Life Technologies). As an internal control, a renilla luciferase plasmid (pRL-SV40 from Promega) was co-transfected. After five hours, transfection reagents were replaced with fresh media. 24-hours post transfection, cells were harvested and luciferase reporter levels were compared to renilla reporter activity using Dual-Luciferase Reporter Assay System (Promega).
9
Infectious Recombinant BmNPV Production
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To prepare infectious recombinant BmNPVs, each recombinant BmNPV bacmid was injected into silkworm larvae together with 1,2-dimyristyloxypropyl-3-dimethyl-hydroxyethyl ammonium bromide (DMRIE-C, Life Technologies Japan, Tokyo, Japan). Silkworm larvae were reared on an artificial diet, Silkmate 2 S (Nosan, Yokohama, Japan), for 6–7 days, and hemolymph was then collected from the silkworm larvae. This hemolymph was used to coexpress recombinant hIgG with human glycosyltransferases as an infectious recombinant BmNPV solution.
To coexpress hIgG and hGnT II, the hemolymph from a BmNPV CP−Chi−/29IJ6 IgG bacmid-injected silkworm larva was mixed with the hemolymph from either a BmNPV CP−Chi−/PAct-hGnT II bacmid- or BmNPV CP−Chi−/PPol-hGnT II bacmid-injected silkworm larva. The hemolymph was diluted with phosphate-buffered saline (PBS, pH 7.4), and 5 × 105 pfu of total recombinant BmNPVs was injected into silkworm pupae. The silkworm pupae were subsequently incubated for 4 days and were maintained at −80 °C before use.
To coexpress hIgG and hGnT II, the hemolymph from a BmNPV CP−Chi−/29IJ6 IgG bacmid-injected silkworm larva was mixed with the hemolymph from either a BmNPV CP−Chi−/PAct-hGnT II bacmid- or BmNPV CP−Chi−/PPol-hGnT II bacmid-injected silkworm larva. The hemolymph was diluted with phosphate-buffered saline (PBS, pH 7.4), and 5 × 105 pfu of total recombinant BmNPVs was injected into silkworm pupae. The silkworm pupae were subsequently incubated for 4 days and were maintained at −80 °C before use.
10
Cell Culture Protocols for Various Cell Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The human embryonic kidney 293T (HEK293T) and human hepatoma Huh7 cell lines were cultured in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% fetal bovine serum (FBS). A549, a human lung carcinoma cell line, was cultured in F12K medium supplemented with 10% FBS. Mouse neuroblastoma cell line N18 (35 (link)) was cultured in RPMI with 5% FBS. All cell lines were incubated at 37°C in 5% CO2. BHK-21 cells harboring DENV2 replicon (36 (link)) were cultured in DMEM with 10% FBS and selected by 500 μg/ml G418. Plasmid DNA and DENV RNA transfection experiments were performed by PolyJet (SignaGen Laboratories) and DMRIE-C (Invitrogen), respectively, according to the manufacturer's instructions. The Huh7 cells stably expressing control short hairpin RNA (shRNA) (Ctrl) or shRNA targeting Ubc9 have been described elsewhere (31 (link)).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!