Cell pellets were then collected after 18 h of Dox induction, and then fixed with 1% formaldehyde for 10 min, approximately 1 to 4 million cells were prepared for each ChIP-seq experiment. ChIP experiments were performed as described previously [47 (link), 48 (link)], with sheared chromatin from 1 million cells for H3K27ac or 4 million cells for ΔNp63α using the iDeal ChIP-seq kit for TFs (Diagenode: C01010055). ChIP for ΔNp63α was carried out using ~ 3 ug each of 4A4 mouse monoclonal anti-ΔNp63 antibody or anti-HA antibody. ChIP for histone mark H3K27ac was performed using ~ 2 ug of H3K27ac (Diagenode: C15410174) antibody. Sequencing libraries were prepared using ThruPLEX DNA-seq kit from Rubicon Genomics. Samples were submitted to University at Buffalo Genomics and Bioinformatics Core (University at Buffalo, State University of New York; Buffalo, New York) and sequenced on a HiSeq using Standard 50-Cycle Single Read Sequencing. Sequencing and quality control were also performed at the University at Buffalo Genomics and Bioinformatics Core.
H3k27ac
Manufactured by Diagenode
Sourced in United States, Belgium
H3K27ac is a histone modification marker that is associated with active enhancers and promoters. It is a post-translational modification of histone H3 where the 27th lysine residue is acetylated.
Automatically generated - may contain errors
Lab products found in correlation
H3k4me3, by Diagenode (13 mentions)
H3k27me3, by Diagenode (10 mentions)
H3k4me1, by Diagenode (10 mentions)
H3k9me3, by Diagenode (4 mentions)
H3k27me3, by Cell Signaling Technology (4 mentions)
H3k36me3, by Diagenode (3 mentions)
Thruplex dna seq kit, by Takara Bio (2 mentions)
Ideal chip seq kit for tfs, by Diagenode (2 mentions)
Hiseq 2000, by Illumina (2 mentions)
H3k4me2, by Merck Group (2 mentions)
Odyssey clx imaging system, by LI COR (2 mentions)
Lowcell chip kit, by Diagenode (2 mentions)
H3k4me1, by Abcam (2 mentions)
Bioruptor ucd 300, by Diagenode (2 mentions)
Formaldehyde, by Merck Group (2 mentions)
H3k36me3 antibodies, by Diagenode (2 mentions)
Qiaquick minelute pcr purification kit, by Qiagen (2 mentions)
Hdac1, by Diagenode (2 mentions)
Nextseq 500, by Illumina (2 mentions)
Sequencing adapter oligos, by Illumina (1 mentions)
37 protocols using h3k27ac
1
ΔNp63α and H3K27ac ChIP-seq Protocol
2
ChIP-Seq Protocol for Pluripotency Factors
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cells were crosslinked in 1% formaldehyde for 10 min at 37 °C with constant stirring, followed by quenching with 125 mM glycine for 5 min at room temperature. Cells were rinsed with 1X PBS and lysed, and chromatin was sheared using a Branson sonicator to a DNA fragment range of 200–1000 base pairs. Chromatin was incubated with antibody at 4 °C overnight with constant rotation. Co-immunoprecipitation of antibody-protein complexes was performed using Protein A or Protein G Dynabeads for 1 h at 4 °C. ChIP libraries were completed using previously reported method51 (link). In brief, immunoprecipitated DNA was end repaired using the End-IT DNA End-Repair Kit (Epicentre), extended using Klenow fragment (3’−5’ exo) (NEB), and ligated to sequencing adapter oligos (Illumina). Each library was PCR-amplified using PFU Ultra II Hotstart Master Mix (Agilent), and a size range of 300–600 base pairs selected for sequencing. Immunoprecipitation was carried out using following antibodies: OCT4 (Santa Cruz, sc-8628x; 5 ug per 106 cells), SOX2 (Santa Cruz, sc-17319; 5 ug per 106 cells), H3K4me2 (Millipore, 07–030; 5 ul per 106 cells), H3K27ac (Diagenode, C15410196; 1 ug per 106 cells). Libraries were sequenced on the Illumina Hiseq 2000.
3
ChIP-seq of Primary Human Tumors
4
CUT&RUN Profiling of Epigenetic Marks
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
CUT&RUN experiments were performed as previously described [20 (link)]. For each condition, 100,000 cells were incubated overnight with (1:100) dilution of the following antibodies, H3K27ac (#C15410174, Diagenode), H3K4me1 (#C15410194, Diagenode), H3K4me3 (#C15410003, Diagenode), H3K27me3 (#C15410069, Diagenode), and (1:50) delusion of RUNX1/ETO (#C15310197, Diagenode), RUNX1 (#ab35962; Abcam), CBFB (#C15310002, Diagenode), and Rabbit IgG (#C15410206, Diagenode). The nuclease pAG/MNase (addgene #123461) was produced and purified in-house. Libraries were constructed from released DNA and subjected to paired-end Illumina sequencing (2 × 150 cycle).
5
ChIP-seq of H3K27ac in NRVMs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
NRVM were fixed for 10 min with 1% formaldehyde (Pierce, Thermofisher Scientific), then sonicated using a Covaris (Woburn, MA) following the manufacturer’s recommendations. Sonicated chromatin was incubated overnight with antibodies against H3K27ac (Diagenode C15410196). Antibody-chromatin complexes were isolated with an equal ratio of Protein A and Protein G dynabeads (ThermoFisher Scientific), then washed three times with RIPA buffer (50 mM HEPES–KOH pH 7.6, 500 mM LiCl, 1 mM EDTA, 1% NP-40, 0.7% Na deoxycholate) and once with Tris–EDTA. Samples were eluted with 50 mM Tris–HCl pH 8.0, 10 mM EDTA, 1% SDS, then treated with RNase A and proteinase K, and crosslinks were reversed at 65 °C overnight. DNA was purified by PCR purification kit (Qiagen). DNA was quantified with SYBR Green Master Mix (ThermoFisher Scientific), relative to input chromatin. Primers used for the Crip2 promoter were as follows: ACTAGTGTGACCGGGAGTAG (forward); GAGCACGTTAGAGGCAGAAG (reverse).
6
Western Blot Analysis of IPF Fibroblasts
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Whole lysates of control and IPF fibroblasts were harvested in RIPA buffer (Sigma-Aldrich, R0278) supplemented with a protease inhibitor cocktail (Thermo Fisher Scientific, 78430). SDS-PAGE electrophoresis was used to separate proteins using the Mini-PROTEAN® TGX™ Precast Gels (Bio-Rad, 4561085) with Precision Plus Protein™ Dual Xtra Prestained Protein Standards (Bio-Rad, 1610377). Samples were transferred to PVDF membranes using the Trans-Blot® Turbo™ Transfer System (Bio-Rad) and the membranes were blocked for 1 h at room temperature (RT) in blocking buffer (3% BSA in PBS) before they were incubated overnight at 4 °C in a 3% BSA-TTBS (Tris-buffered saline with Tween) blocking buffer with the following antibodies: β-actin (BioLegend, 643802), H3K4me1 (Diagenode, C15410194), H3K4me3 (Diagenode, C15410003) and H3K27ac (Diagenode, C15410196). The membranes were washed 3 times in TTBS for 5 mins and incubated with IRDye® 800CW Goat anti-Mouse (LI-COR, 926-32210) and IRDye® 680RD Donkey anti-Rabbit (LI-COR, 926-68073) for 1 h at RT before they were washed and imaged on the LI-COR Odyssey CLx imaging system.
7
ChIP-seq protocol for LNCaP cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
ChIP in LNCaP was performed according to published protocols36 (link). Ten million cells were fixed with 1% formaldehyde at room temperature for 10 min and quenched. Cells were collected in lysis buffer (1% NP-40, 0.5% sodium deoxycholate, 0.1% SDS and protease inhibitor (#11873580001, Roche) in PBS)37 (link). Chromatin was sonicated to 300–800 bp using a Covaris E220 sonicator (140 watt peak incident power, 5% duty cycle, 200 cycleburtst). Antibodies (FOXA1, ab23738, Abcam; H3K27ac, C15410196, Diagenode; ASCL1, ab74065) were incubated with 40 μl of Dynabeads protein A/G (Invitrogen) for at least 6 h before immunoprecipitation of the sonicated chromatin overnight. Chromatin was washed with LiCl wash buffer (100 mM Tris pH 7.5, 500 mM LiCl, 1% NP-40, 1% sodium deoxycholate) six times for 10 min sequentially.
8
ChIP Assay of Immune Cell Enhancers
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
ChIP was performed using the Low Cell# ChIP kit (catalogue ID C01010072, Diagenode, Liege, Belgium) as previously described.11 (link) For each ChIP, 3×105 monocytes, either unstimulated or LPS stimulated for 24 hours, were used. DNA was isolated with the Low Cell# ChIP kit (Diagenode) and qPCR performed on immune complex-associated DNA using allele-specific primers for rs4265380 (WT sense primer: 5′-TGACGCAATTTGGGCTAC-3′; AS-risk sense primer: 5′-TGACGCAATTTGGGCTAT-3′; common antisense primer: 5′-CCAGCTGTGTCATTCTCCAA-3′), detected with SYBR Green (Qiagen Ltd) on ABI ViiA 7 PCR device (Applied Biosystems, Paisley, UK).
Relative occupancy was calculated as a ratio of specific signal over background: % input (specific loci)/% input (background loci). The following ChIP grade antibodies were used: p300 ((C-20), SC585X, Santa Cruz Biotechnology, Dallas, USA), H3K4Me1 (Diagenode, Mab-150–050), H3K79Me2 (Diagenode, C15410051), H3K27Ac (Diagenode, Mab-184–050) and IgG (Diagenode, K02041008).
Relative occupancy was calculated as a ratio of specific signal over background: % input (specific loci)/% input (background loci). The following ChIP grade antibodies were used: p300 ((C-20), SC585X, Santa Cruz Biotechnology, Dallas, USA), H3K4Me1 (Diagenode, Mab-150–050), H3K79Me2 (Diagenode, C15410051), H3K27Ac (Diagenode, Mab-184–050) and IgG (Diagenode, K02041008).
9
HiChIP Profiling of H3K27ac and H3K4me3 in LNCaP Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
HiChIP was performed as previously described39 (link). Trypsinized LNCaP cells (10 million) were fixed with 1% formaldehyde at room temperature for 10 min and quenched. The sample was lysed in HiChIP lysis buffer and digested with MboI (NEB) for 4 h. After 1 h of biotin incorporation with biotin dATP, the sample was ligated with T4 DNA ligase for 4 h with rotation. Chromatin was sonicated using Covaris E220 (conditions: 140 PIP, 5% DF, 200 CB) to 300–800 bp in ChIP lysis buffer (1% NP-40, 0.5% sodium deoxycholate, 0.1% SDS and protease inhibitor in PBS) and centrifuged at 13,000 rpm. for 10 minutes at 4°C. Preclearing 30μl of Dynabeads protein A/G for 1 h at 4°C was followed by incubation with antibodies (H3K27ac, Diagenode, 3C15410196; H3K4me3, Diagenode 3C15410003). Reverse-crossed IP sample were pulled down with streptavidin C1 beads (Life Technologies), treated with Transposase (Illumina) and amplified with reasonable cycle numbers based on the qPCR with a 5-cycle pre-amplified library. The library was sequenced with 150-BP PE reads on the Illumina HiSeq 2500 Sequencing platform (Novogene).
10
Chromatin Immunoprecipitation Assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
ChIP was performed with 10,000 FACS-sorted cells per IP using Diagenode Low Cell ChIP kit (cat# C01010072) according to manufacturer’s protocol. 1 µg of corresponding antibody from Diagenode was used per IP: H3K4me3 (cat# C15410003-50, lot# A5051-001P), H3K4me1 (cat# C15410194, lot# A1862D), H3K27ac (cat# C15410196, lot# A1723-0041D), H3K27me3 (cat# C15410195, lot# A1811-001P).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!