Sybr master mixture

TRIzol reagent (Takara, Dalian, China) was used to extract total RNA. Total RNA concentration and purity were determined by a NanoDrop ND-1000 spectrophotometer (Thermo Fisher Scientific, DE, USA). Next, 1 µg RNA was reversely transcribed into cDNA using a PrimeScript RT kit (Takara, Tokyo, Japan). Levels of mRNAs were measured using SYBR Master Mixture (Takara, Dalian, China) and calculated with 2^–ΔΔCt method [15 (link)]. The sequences of the primers were as follows: PTPRO forward: 5′- TATTGTGAGCCTCCGTGTGT −3′, reverse: 5′- GCCAAGCCTTTTCAGTGACA −3′; ERp44 forward: 5′-CCTGTGCCAGGCCTCAATAC −3′, reverse: 5′-TGGCACTGGGCTTCCTGATA −3′; MMP-2 forward: 5′-GCCCCAGACAGGTGATCTTG-3′, reverse, 5′-GCTTGCGAGGGAAGAAGTTGT-3′; MMP-9 forward: 5′- AGACGGGTATCCCTTCGACG −3′, reverse, 5′-AAACCGAGTTGGAACCACGAC −3′; GAPDH forward: 5′- ACCACAGTCCATGCCATCAC −3′, reverse, 5′- TCCACCACCCTGTTGCTGTA −3′.

Total RNA used for the qPCR analysis was isolated and purified as described above. Briefly, approximately 2 μg of the RNA sample was used for strand complementary DNA synthesized by either oligo dT primers or random primer mixes using a Superscript III Reverse Transcriptase kit. Real-time PCR amplification was carried out in the presence of 12.5 µl of SYBR master mixture (Takara Bio Inc.), 1 µl of cDNA template, and target gene-specific primers in a CFX96 System under the following conditions: 1) 1 min at 95°C; 2) 5 s at 95°C; 3) 30 s at 50°C; 4) 30 s at 72°C with a plate reader; and 5) repeat steps 2), 3), and 4) for another 39 cycles. The housekeeping gene, serine–tRNA ligase, putative (PF3D7_0717700), was used to normalize the gene transcriptional level of each sample. Primers for detecting different transcripts from the 37°C control group and the 26°C treatment group were designed in this study. The primer sequences for PCR are listed in Supplementary Table S1.

After harvesting GCTB stromal cells with different treatments and GCTB tissues, a TRIzol^® reagent (Gibco, Grand Island, NY, USA) was applied to isolate the total RNAs, which were quantified using a NanoDrop 2000 spectrophotometer (ThermoFisher Scientific, WA, USA). Subsequently, the RNAs were reverse transcribed into cDNA using the Revert Aid First Strand cDNA Synthesis kit (Promega Corporation, WI, USA). Immediately after, real-time PCR was conducted on ABI 7500 Real-time PCR Systems (Applied Biosystems, CA, USA) with SYBR Master Mixture (Takara, Kusatsu, Japan). β-actin was applied as an internal reference, and the 2^-∆∆CT method was performed to quantify the relative expression of different molecules. Primer sequences are displayed in Table 1.

Total RNA was extracted from lentivirus infected gastric cancer cells using Trizol. cDNA synthesis was performed using M-MLV Reverse Transcriptase (M1705, Promega, USA) following manufacturer’s instruction. Real-time PCR was performed with 7500 Real Time PCR system (Applied Agilent, USA) using SYBR Master Mixture (DRR041B, Takara, Otsu, Japan). Relative expression of CCT3 was calculated as 2^-ΔΔCt using GAPDH as internal reference. The sequences of the primer pairs were: CCT3 forward: 5’-TCAGTCGGTGGTCATCTTTGG-3’; CCT3 reverse: 5’- CCTCCAGGTATCTTTTCCACTCT-3’; GAPDH: 5’-TGACTTCAACAGCGACACCCA-3’; GAPDH reverse: 5’-CACCCTGTTGCTGTAGCCAAA-3’. Sequences of the other primers used in this study are provided in the Supplement of this article. Relative expression of genes was calculated as 2-ΔΔCt using GAPDH as internal reference. Reactions were performed in triplicate. Statistical significance was tested using t-test.