Plv ef1α mcs ires bsd

Manufactured by Biosettia

Sourced in United States, China

The PLV-EF1α-MCS-IRES-Bsd is a lentiviral expression vector that enables the expression of a gene of interest under the control of the EF1α promoter. It contains a multiple cloning site (MCS) for insertion of the gene, an internal ribosome entry site (IRES), and a blasticidin resistance gene (Bsd) for selection of transduced cells.

Automatically generated - may contain errors

Lab products found in correlation

Lipofectamine 2000, by Thermo Fisher Scientific (5 mentions) Plv h1 ef1α puro, by Biosettia (4 mentions) Blasticidin, by Thermo Fisher Scientific (3 mentions) Puromycin, by Thermo Fisher Scientific (2 mentions) Plv h1 ef1α puro vector, by Biosettia (2 mentions) Transstart fastpfu dna polymerase kit, by Transgene (2 mentions) Fetal bovine serum (fbs), by Thermo Fisher Scientific (2 mentions) M mlv reverse transcriptase, by Thermo Fisher Scientific (2 mentions) Lipofectamine 3000 reagent, by Thermo Fisher Scientific (1 mentions) Tet plko puro, by Addgene (1 mentions) Sirnas, by GenePharma (1 mentions) Pspax2, by Addgene (1 mentions) Pmd2 g, by Addgene (1 mentions) Plko 1, by Addgene (1 mentions) Enhanced chemiluminescence detection kit, by Merck Group (1 mentions) Prmi 1640, by Thermo Fisher Scientific (1 mentions) Sybr premix ex taq kit, by Takara Bio (1 mentions) Polybrene, by Merck Group (1 mentions) Mir 451a mimic, by RiboBio (1 mentions) Gel imaging system, by Syngene (1 mentions)

15 protocols using plv ef1α mcs ires bsd

Generating Lentiviral Vectors with shRNAs

Check if the same lab product or an alternative is used in the 5 most similar protocols

Oligos encoding shRNAs for p38β (p38β-sh751: 5′-AAAAGCTGAAGCGCATCATGGAATTGGATCCA ATTCCATGATGCGCTTCAGC-3′ and p38β-sh652: 5′-AAAAGCATTACAACCAAACAGTGTTGGATCCA ACACTGTTTGGTTGTAATGC-3′), shRNAs for PRAK (shPK-1: 5′-GCTGGAATTAGTGGTCCAG-3′ and shPK-2: 5′-GTGTCTATATCCACGACCA-3′), and shRNAs for MK2 (shMK2-1: 5′-GGAGAACTCTTTAGCCGA ATC-3′ and shMK2-2: 5′-GCCATCCAGTATCTGCATT CA-3′) were designed, synthesized, and inserted into pLV-H1-EF1α-puro (Biosettia), according to manufacturer′s protocol. Human HA-SOX2 plasmid was amplified by PCR using TransStart FastPfu DNA Polymerase kit (TransGen Biotech, AP221), and inserted into pLV-EF1α-MCS-IRES-Bsd (Biosettia). The Hsp27 mutant plasmids were constructed using the method described by Anna M. Knapinska [33 (link)] and inserted into pLV-EF1α-MCS-IRES-Bsd (Biosettia).
All mutants were verified by DNA sequencing. Recombinant lentiviruses were packaged and transduced into cells as described previously [53 (link)].

Fang Y., Wang J., Wang G., Zhou C., Wang P., Zhao S., Zhao S., Huang S., Su W., Jiang P., Chang A., Xiang R, & Sun P. (2017). Inactivation of p38 MAPK contributes to stem cell-like properties of non-small cell lung cancer. Oncotarget, 8(16), 26702-26717.

+ Open protocol

+ Expand

Cloning and Lentiviral Production of ZEB1

Check if the same lab product or an alternative is used in the 5 most similar protocols

The human cDNA fragment encoding ZEB1 was prepared by PCR and cloned into pLV-EF1α-MCS-IRES-Bsd (Biosettia). The lentiviruses were generated by transfecting subconfluent 293T cells with lentiviral vectors and packaging plasmids using the Lipofectamine 3000 reagent (Invitrogen). The primer sequences are listed in Additional file 1: Table S1.

Li J., Kou Y., Zhang X., Xiao X., Ou Y., Cao L., Guo M., Qi C., Wang Z., Liu Y., Shuai Q., Wang H, & Yang S. (2022). Biochanin A inhibits lung adenocarcinoma progression by targeting ZEB1. Discover. Oncology, 13, 138.

+ Open protocol

+ Expand

Plasmid Construction and RNAi Knockdown

Check if the same lab product or an alternative is used in the 5 most similar protocols

Plasmid expressing EIF2S1 was constructed using a base vector of pLV‐EF1α‐MCS‐IRES‐Bsd (Biosettia). ShRNA targeting EIF2A, GCTCTATCTTGCACAAGTA, was cloned into Tet‐PLKO‐puro (Addgene). ShRNA targeting EIF2S1 was cloned into pLKO.1 (Addgene). ShRNA sequences for EIF2S1 3′ UTR were: a#, GCAGGTAGTTTGTACCATTTA; b#, GCCAGAGAATAGATCAGTATT. Helper plasmids for lentiviral production are pMD2.G (Addgene) and psPAX2 (Addgene). SiRNAs were purchased from Genepharma and the sequences were as follows (5 'to 3'): for ATF4,a# GTGAGAAACTGGATAAGAA, b# GCCTAGGTCTCTTAGATGA; for EIF2A, a# GCTCTATCTTGCACAAGTA, b# GGTTAATAATGGATACAAA; for HSPA5, a# GGAGCGCATTGATACTAGA, b# CAGATGAAGCTGTAGCGTA; for EIF2AK1, a# GATTAAGGGTGCAACTAAA, b# CGAAGAATCTTCCGAAGAA; for EIF2AK2, a# GACGGAAAGACTTACGTTA, b# GGTGAAGG TAGATCAAAGA; for EIF2AK3, a# GATTCGCAAGACCTTCAAT, b# CGCGGCAGGTCATTAGTAA; for EIF2AK4, a# GGTCCAAGGAAGCACCAAA, b# GGATCCCTTTTGCAAGATA.

Chen L., He J., Zhou J., Xiao Z., Ding N., Duan Y., Li W, & Sun L. (2019). EIF2A promotes cell survival during paclitaxel treatment in vitro and in vivo. Journal of Cellular and Molecular Medicine, 23(9), 6060-6071.

+ Open protocol

+ Expand

Overexpression of miR-370-3p in HepG2 Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

The HepG2^CYP2D6 cells were constructed using the lentiviral expression vector pLV-EF1α-MCS-IRES-Bsd (Biosettia, San Diego, CA) as described in our previous study [19 (link)]. Cells were seeded in 24-well plates at a density of 2 × 10⁵ cells per well and incubated overnight without antibiotics. miRNAs (Intergrated DNA Technologies) including miRNA mimic negative control, hsa-miR-370-3p mimic, hsa-miR-370-3p mimic-mutant, miRNA inhibitor negative control, or hsa-miR-370-3p inhibitor were mixed with lipofectamine 2000 (Thermo Scientific) and transfected into cells at a final concentration of 50 nmol/L. Cells were collected 48 h after transfection to perform reverse-transcription PCR (RT-PCR) and Western blot analyses, respectively. Each independent experiment was performed in triplicate.

Zeng L., Chen Y., Wang Y., Yu L.R., Knox B., Chen J., Shi T., Chen S., Ren Z., Guo L., Wu Y., Liu D., Huang K., Tong W., Yu D, & Ning B. (2017). MicroRNA hsa-miR-370-3p suppresses the expression and induction of CYP2D6 by facilitating mRNA degradation. Biochemical pharmacology, 140, 139-149.

+ Open protocol

+ Expand

Fbxw11 Expression Analysis in Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

PRMI-1640, fetal bovine serum (FBS), and M-MLV reverse transcriptase were purchased from Thermo Fisher Scientific (Carlsbad, CA). The SYBR Premix Ex Taq Kit was obtained from TaKaRa Biotech (Dalian, China). The monoclonal antibody against mouse Fbxw11 was purchased from Sigma-Aldrich (St. Louis, MO). The enhanced chemiluminescence detection kit was purchased from Millipore (Bedford, MA). The lentivirus-based vector pLV-EF1α-MCS-IRES-Bsd (Cat# cDNA-pLV03) and pLV-H1-EF1α-red (Cat# SORT-B11) were obtained from Biosettia Inc. (San Diego, CA).

Wang L., Feng W., Yang X., Yang F., Wang R., Ren Q., Zhu X, & Zheng G. (2018). Fbxw11 promotes the proliferation of lymphocytic leukemia cells through the concomitant activation of NF-κB and β-catenin/TCF signaling pathways. Cell Death & Disease, 9(4), 427.

+ Open protocol

+ Expand

Lentiviral overexpression and knockdown of HTR1E

Check if the same lab product or an alternative is used in the 5 most similar protocols

The coding sequence of HTR1E was synthesized by Sangon Biotech (Shanghai, China) and cloned into plasmid pLV-EF1α-MCS-IRES-Bsd (Biosettia, San Diego, CA, USA). Stable HTR1E overexpressing was conducted in OVCAR-5 cell line. Lentivirus-based RNAi vector pLV-H1-EF1α-puro (Biosettia) with the insertion of shRNA templates were used to conduct HTR1E knocking down in SK-OV-3 cell line. Cells infected with lentivirus for knocking down or reconstituted expression were selected with 4 μg/mL of blasticidin or 10 μg/mL of puromycin (Thermo-Fisher Scientific, Waltham, MA, USA) for one week. The sequences of the shRNA used were as follow: shHTR1E-#1, 5' AAAAGCATGGCTATAAGACCCAAGATTGGATCCA 3'; shHTR1E-#2, 5' AAAAGCCAACTACCTAATCTGTTCTTTGGATCCA 3'; shCtrl, 5' AAAAGCAGTTATCTGGAAGATCAGGTTGGATC 3'.

Qin X., Li J., Wang S., Lv J., Luan F., Liu Y., Chen Y., Chen X., Zhao Y., Zhu J., Piao Y., Zhang W., Shi Y., Xiang R., Qu P, & Wang L. (2021). Serotonin/HTR1E signaling blocks chronic stress-promoted progression of ovarian cancer. Theranostics, 11(14), 6950-6965.

+ Open protocol

+ Expand

Overexpression and Silencing of KDM6B

Check if the same lab product or an alternative is used in the 5 most similar protocols

Gene expression: The DNA sequence encoding human KDM6B was PCR-amplified from the plasmid pCMV-HA-KDM6B (Addgene, Cambridge, MA) and cloned into plasmid pLV-EF1α-MCS-IRES-Bsd (Biosettia, San Diego, CA). Gene silencing: short hairpin RNA (shRNA) sequences targeting KDM6B were cloned into the pLV-H1-EF1α-puro vector (Biosettia). Lentiviruses carrying the overexpression vectors, gene silencing vectors, or empty vectors were produced according to the manufacturer's instruction. To establish stable recombinant cell lines, lentivirus-containing medium was added to cells in the presence of 8 μg/mL polybrene for 48 h before selection with 10 μg/mL blasticidin or 1 μg/mL puromycin for 1 week.

Xun J., Du L., Gao R., Shen L., Wang D., Kang L., Chen C., Zhang Z., Zhang Y., Yue S., Feng S., Xiang R., Mi X, & Tan X. (2021). Cancer-derived exosomal miR-138-5p modulates polarization of tumor-associated macrophages through inhibition of KDM6B. Theranostics, 11(14), 6847-6859.

+ Open protocol

+ Expand

Expanded CYP Expression Cell System

Check if the same lab product or an alternative is used in the 5 most similar protocols

Previously we created eight TK6 cell lines individually expressing CYP1A1, 1A2, 1B1, 2A6, 2B6, 2C9, 2C19, and 3A4 with the detailed methods described (Li et al., 2020a (link)). In the present study, we expanded our cell system and constructed an additional six cell lines stably transduced with CYP2C8, 2C18, 2D6, 2E1, 3A5, and 3A7 individually using the same methods described previously. Briefly, the six human CYP cDNAs were individually subcloned into the lentiviral expression vector pLV-EF1α-MCS-IRES-Bsd (Biosettia Inc., San Diego, CA) along with an in-frame c-Myc extension added to the carboxyl terminus of each recombinant CYP protein. The production of lentivirus was conducted following the manufacturer’s instructions. For lentiviral transduction, TK6 cells were seeded at a density of 2.5 × 10⁵ cells per well in 6-well tissue culture plates and then were infected with lentivirus at a multiplicity of infection (MOI) of 10 with 8 µg/ml polybrene (Sigma, St. Louis, MO) by centrifuging at 1,000 × g for 60 min at room temperature. The transduction medium was replaced with fresh complete medium after centrifugation. Forty-eight hours after transduction, transduced cells were selected in the presence of 8 µg/ml blasticidin to generate stable TK6 cell lines expressing individual CYPs.

Li X., He X., Chen S., Guo X., Bryant M.S., Guo L., Manjanatha M.G., Zhou T., Witt K.L, & Mei N. (2020). Evaluation of pyrrolizidine alkaloid-induced genotoxicity using metabolically competent TK6 cell lines. Food and chemical toxicology : an international journal published for the British Industrial Biological Research Association, 145, 111662.

+ Open protocol

+ Expand

Western Blotting and Plasmid Transfection

Check if the same lab product or an alternative is used in the 5 most similar protocols

Western blotting was performed in accordance with a previous protocol [18] . Briefly, proteins were loaded on 5-12% tris-acrylamide gels and membranes were blotted with specific antibodies. The LPIN1 antibody (Cat. 14906, Cell Signaling Technology, USA) was diluted to 1:1000. Bands were detected using a Gel imaging system (SYNGENE, USA).
Plasmid construction and transfection SMMC-7721, Hep3B, and HUVECs (3 × 10 5 cells/well) were seeded in 6-well plates, incubated overnight, and then transfected with miR-451a mimics (Ribobio Co., China) using Lipofectamine2000 (Invitrogen) and Opti-MEM (Corning) according to the manufacturer's instruction. Negative control (NC) is also purchased from Ribobio Co.
To construct the human LPIN1 overexpression vector, human LPIN1 cDNA was cloned from SMMC-7721 cells and ligated into pLV-EF1α-MCS-IRES-Bsd (Biosettia Inc., USA). For gene silencing, shLPIN1 DNA oligomers were annealed and cloned into pLV-H1-EF1α-puro vector (Biosettia Inc., USA). These sequences are listed in the supplementary materials section. Scrambled control (SC) sequences were used as in a previous report [16] .

Zhao S., Li J., Zhang G., Wang Q., Wu C., Zhang Q., Wang H., Sun P., Xiang R, & Yang S. (2019). Exosomal miR-451a Functions as a Tumor Suppressor in Hepatocellular Carcinoma by Targeting LPIN1. Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 53(1).

+ Open protocol

+ Expand

Legumain overexpression in mRTECs

Check if the same lab product or an alternative is used in the 5 most similar protocols

Mouse legumain cDNA was amplified by reverse transcription-PCR and then ligated into pLV-EF1α-MCS-IRES-Bsd (Biosettia, San Diego, CA). mRTECs were transfected with the pLV-EF1α-legumain-IRES-Bsd plasmid. Cells were seeded in a 6-well plate containing medium without penicillin-streptomycin and then transfected using Lipofectamine™ 2000 transfection reagent (Invitrogen).

Chen C., Wang D., Yu Y., Zhao T., Min N., Wu Y., Kang L., Zhao Y., Du L., Zhang M., Gong J., Zhang Z., Zhang Y., Mi X., Yue S, & Tan X. (2021). Legumain promotes tubular ferroptosis by facilitating chaperone-mediated autophagy of GPX4 in AKI. Cell Death & Disease, 12(1), 65.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!