The largest database of trusted experimental protocols

Dapsone

Manufactured by Merck Group
Sourced in United States

Dapsone is a laboratory product manufactured by Merck Group. It is a chemical compound used as a reference standard or analytical tool in various laboratory applications. Dapsone has a well-defined chemical structure and known purity, making it suitable for use in analytical procedures, quality control, and research activities. The core function of Dapsone is to serve as a reliable and standardized material for these laboratory purposes.

Automatically generated - may contain errors

12 protocols using dapsone

1

Simultaneous Quantification of Dapsone and Metabolite

Check if the same lab product or an alternative is used in the 5 most similar protocols
All reference standards for the probe drug and monoacetylDapsone (MADS) were
purchased from trustworthy sources like Sigma-Aldrich (St. Louis, MO). Dapsone,
MADS, SMZ, sodium dihydrogen phosphate, and monohydrogen phosphate were
purchased from Sigma and Sigma-Aldrich (St. Louis, MO), double distilled water
was obtained from High Tech Lab of the Institute, Adventec Japan (CPW 200, GS
590, distillery), University of Agriculture, Faisalabad, Pakistan.
Acetone, acetonitrile, and methanol and all other solvents and chemicals having
high purity were of high-pressure liquid chromatography (HPLC) grade and
purchased from Sigma/Sigma-Aldrich, PanReac AppliChem ITW Reagents, and RCI
Labscan Limited. Drug-free plasma was obtained from District Headquarter
Hospital, Faisalabad, Pakistan.
+ Open protocol
+ Expand
2

Regulation of Bitter Taste Receptor T2R4

Check if the same lab product or an alternative is used in the 5 most similar protocols
HEK293T cells were obtained from ATCC and maintained in 10% fetal bovine serum at 37°C in a 95% air and 5% CO2 chamber. hASMCs were a kind gift from Dr Andrew Halayko, Dept. of Physiology, University of Manitoba [20 (link)]. Quinine hydrochloride, yohimbine, denatonium benzoate, dapsone, parthenolide and dextromethorphan hydrobromide (DXM) were purchased from Sigma Aldrich (ON, Canada). Brefeldin A (BFA) was purchased from Cell Signaling Technology (ON, Canada), Mouse monoclonal M2 anti-FLAG antibody was from Sigma Aldrich and rabbit polyclonal anti-T2R4 antibody was from ThermoFisher Scientific (Toronto, ON, Canada). Goat anti-mouse Alexa Fluor-488 and goat anti-rabbit Alexa Fluor-488 were purchased from Molecular Devices (CA, USA). APC conjugated anti-FLAG monoclonal antibody was from BioLegend (CA, USA). The synthetic oligonucleotide primer sequences for human TAS2R4 (F -TCCTGCTGAAGCGGAATATC; R–GAAAAGGTGATGCCTGGCTA) were purchased from Invitrogen.
+ Open protocol
+ Expand
3

Development of Erythromycin-loaded Dapsone Nanoparticles

Check if the same lab product or an alternative is used in the 5 most similar protocols
Dapsone, Cholesterol, Span 20, and Rhodamine B dye were purchased from Sigma-Aldrich Co., St. Louis, MO, USA. Chloroform, methanol, sodium lauryl sulfate, carbopol 945, triethanolamine (TEA), disodium hydrogen phosphate, and potassium dihydrogen phosphate were purchased from Adwic, El Nasr Pharmaceutical Chemicals Co., Abu Zaabal, Egypt. Cremophor RH was purchased from BASF Co. (Florham Park, NJ). Spectra/PoreVR dialysis membrane 12,000–14,000 molecular weight cut off was from Spectrum Laboratories Inc., Rancho Dominguez, CA. Tissue-Tek® O.C.T. Compound gel was from Sakura Finetek, USA. Aknemycin® ointment containing 2% erythromycin manufactured by Medical Union Pharmaceuticals (Ismailia, Egypt under license from Almirall Hermal, Germany) was purchased from a local pharmacy (Cairo, Egypt).
+ Open protocol
+ Expand
4

Screening of TAS2R Agonists for Biological Activity

Check if the same lab product or an alternative is used in the 5 most similar protocols
The TAS2R agonists chloroquine diphosphate, quinine hydrochloride dihydrate, saccharin sodium hydrate, denatonium benzoate, 1,10-phenanthroline hydrochloride monohydrate, ofloxacin, strychnine hemisulphate, erythromycin, dapsone, carisoprodol, and sodium cromoglycate were obtained from Sigma-Aldrich (Saint-Quentin Fallavier, France) and diphenidol hydrochloride was provided by TCI Europe (Zwijndrecht, Belgium). All products were solubilized and diluted in sterile water, with the exception of erythromycin, dapsone, and carisoprodol, which were solubilized in DMSO and then diluted in water. Antibiotics, DMSO, L-glutamine, trypan blue dye, heat-inactivated fetal calf serum and LPS (from E. coli serotype 0111:B4) were purchased from Sigma (St. Louis, MO, United States). RPMI medium was from Eurobio Biotechnology (Les Ulis, France).
+ Open protocol
+ Expand
5

Validated Quantitative Analysis of EPI in Human and Rat Liver Microsomes

Check if the same lab product or an alternative is used in the 5 most similar protocols
EPI (purity >98%) was purchased from Chengdu Pharmaceutical Co., Ltd. (Chengdu, China). Berberine (the internal standard [IS], purity ≥98%) was obtained from the National Institute for Control of Pharmaceutical and Biological Products. HLM and RLM were procured from Huizhi Kangtai Tech (iPhase Pharmaceutical Services, Beijing, China). α-Metoprolol, dapsone, phenacetin, chlorzoxazone and tolbutamide were Sigma (Sigma–Aldrich Chemical Co., St. Louis, USA) products purchased from Beijing Bayer Biology Biotechnology Co., Ltd. 4-Hydroxytoluene sulfonylurea was obtained from Beijing Leon Technology Co., Ltd. α-Hydroxymetoprolol was procured from TRC Co., Ltd (Toronto, Canada). Methanol, acetonitrile and formic acid (HPLC grade) were supplied by Thermo Fisher Technologies Inc. (Pittsburgh, MA, USA). The distilled deionized water used in all experiments was purified by a Milli-Q water purification system (Merck Millipore Co., Darmstadt, Germany). In addition, the remainder of the reagents and chemicals were analytically pure and were purchased from domestic markets.
+ Open protocol
+ Expand
6

Measurement of Nox-Derived Reactive Oxygen Species

Check if the same lab product or an alternative is used in the 5 most similar protocols
RPMI 1640 with Glutamax, DMEM/F12 (1:1), Hanks' buffered salt solution (HBSS), fetal bovine serum (FBS), and Amplex red were purchased from Invitrogen, Paisley, UK. Pest (penicillin, streptomycin), neomycin, ionomycin, phorbolmyristateacetate (PMA), diphenyleneiodoniumchloride (DPI), dapsone, ML-171, Phox-I2, xanthine, hypoxanthine, xanthine oxidase, DMSO, DPPH (2,2-diphenyl-1-1picrylhydrazyl), Tween20, Sucrose, flavin adenine dinucleotide (FAD), Phosphatidic acid, ethylene glycol-bis(β-aminoethyl ether)-N,N,N',N'-tetraacetic acid (EGTA), horseradish peroxidase (HRP) and NADPH were purchased from Sigma–Aldrich. HEK293 overexpressing Nox4 (CJ Nox4) cells were purchased from Redoxis, Lund, Sweden. HEK 293 cells expressing Nox5 and CHO cells expressing Nox1 were a kind gift from the Vincent Jaque Center Medical Universitaire, Geneva, Switzerland. GKT136901, a Nox1/Nox4 selective inhibitor, was a kind gift from prof. Harald HH Schmidt (Maastricht University, Netherlands).
+ Open protocol
+ Expand
7

Dapsone and LPS Interaction in Mice

Check if the same lab product or an alternative is used in the 5 most similar protocols
C57BL/6 mice were purchased from OrientBio (Korea) and maintained in our animal facility. The present study used 8- to 12-week-old mice. All experiments using animal were performed according to the institutional guidelines of Jeju National University for laboratory animal use and care (IACUC No. 2015-0017). Dapsone and LPS purified from Escherichia coli O55 were purchased from Sigma (USA). For use, Dapsone and LPS were dissolved in sterile phosphate buffered saline.
+ Open protocol
+ Expand
8

Quantification of Nitric Oxide in Macrophages

Check if the same lab product or an alternative is used in the 5 most similar protocols
NO levels in culture supernatants of macrophages were quantified by the accumulation of nitrite as a stable end product, according to a modified Griess method [19 (link)]. Cell culture supernatant (100 µL) was mixed with 14 mM 4,4′-diamino-diphenylsulfone (Dapsone, Sigma-Aldrich) in 2 M HCl (50 µL) and 0.1% N-1-naphthylenediamine dihydrochloride (50 µL) in deionized water. The absorbance of the tested culture supernatants at 550 nm was compared with a sodium nitrate standard (NaNO2) curve.
+ Open protocol
+ Expand
9

Purification and Synthesis of Organic Compounds

Check if the same lab product or an alternative is used in the 5 most similar protocols
Pyrrole was purchased from Merck, Germany, and then purified through distillation. Copper sulfate, sodium nitrate, sulfadiazine, acetone, sulfuric acid, hydrochloric acid, dapsone, sulfamethoxazol, dopamine, ascorbic acid, and uric acid were obtained from Sigma Aldrich, Germany. Hexacyanoferrate (II/III) was obtained from FlukaChemika.
+ Open protocol
+ Expand
10

Nitrite Production Assay in BV2 Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
BV2 microglial cells were seeded at 2 × 104 cells/well and treated with compounds at increasing concentrations during 24 h in complete culture media. Then, treatments were removed, and BV2 cells were co-incubated with compounds and LPS (100 ng/mL) (O127:B8, SigmaAldrich, L3129) for additional 18 h in culture media supplemented with 1% FBS. Each plate included non-treated cells as basal nitrite production. Thereafter, nitrite production was determined by using the modified Griess assay. In brief, samples (150 μL) were mixed with DAPSONE (75 μL) (SigmaAldrich, A74807) and NEDA (75 μL) (SigmaAldrich, 33461), and the mixture was incubated at room temperature for 5 min. Light absorption was measured at 550 nm in a microplate reader (SPECTROstar nano, BMG Labtech). Basal nitrite production was referred to as 100% of nitrite production, and all data were normalized to the basal condition. Concentration needed to reduce nitrite production to 50% was calculated from graphical representation of percentage of nitrite production vs. compound concentration, and data were fitted by non-linear regression and interpolated to 50%.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!