Mirneasy serum plasma handbook

MicroRNAs were extracted from plasma using QIAzol lysis reagent and the miRNeasy Serum/Plasma kit (Cat #217184, Qiagen Inc., Alameda, CA, USA) and converted to cDNA using the miScript PCR Starter kit following the manufacturer's instructions (Cat #218193, Qiagen Inc., Alameda, USA). RT-PCR was performed on an StepOnePlus RT-PCR machine (Applied Biosystems, Foster City, California, USA) to detect changes of miR320a and miR15a using commercially available primers following the manufacturer's instructions (Cat #hsa-miR-320a; 5'AAAAGCUGGGUUGAGAGGGCGA, Cat# Hsa_miR-15a; 5'UAGCAGCACAUAAUGGUUUGUG, Qiagen Inc., Alameda, CA, USA). miR320a and Mir15a were normalized the small nuclear RNA U6 (snU6) 5'- CGCAAGGATGACACGCAAATTC. A 9 μl volume (comprised of a mixture of SYBR Green Master Mix, Universal Primer, Primer Assay, and RNase-free water) was added to a 1 μl volume of cDNA (following the structure of miRNeasy Serum/Plasma Handbook, Qiagen). The platter-PCR protocol consisted of the following steps: a single hold phase of 15 minutes at 95°C followed by 40 cycles each of the following:15’ at 94°C, 30’ at 55°C, and 30’ at 70°C. Data was collected at the end of each cycle. Quantitation was by the ΔΔCT method.

All the reagents for these experiments were purchased from ThermoFisher Scientific (formerly Applied Biosystems). cDNA was synthesized with Taqman MicroRNA Reverse Transcription Kit and specific Taqman microRNA Assays. Different amounts of starting material were used depending on the nature of the sample (2 µl of RNA for circulating EVs or 50 ng of RNA from placentas, cells, or cell stimulated EVs). We developed a customized multiplex assay based on manufacturer’s guidelines for simultaneous amplification of several miRNAs. RT-qPCR was performed in duplicates per sample using TaqMan miRNA assays and Taqman Fast Advance Master Mix (Applied Biosystems). miRNAs from cell-samples and placental sections were normalized to U6 small RNA (Rice et al., 2015 (link)), while plasma EV samples were normalized to miR39 as recommended by the miRNeasy Serum Plasma Handbook, (QIAGEN). https://tools.thermofisher.com/content/sfs/manuals/cms_094060.pdf).

Five mL of blood were withdrawn from each patient into a labeled disposable serum collection tube (global roll gel and clot activator tube). For complete clotting, blood samples were kept for one hour at room temperature (15–25 °C); then, samples were processed for serum separation following the miRNeasy serum/plasma handbook-Qiagen, Hilden, Germany, 2012.