The largest database of trusted experimental protocols

Lipofectamine 8000

Manufactured by Beyotime
Sourced in China, United States

Lipofectamine 8000 is a lipid-based transfection reagent used for the delivery of nucleic acids, such as plasmid DNA, siRNA, or mRNA, into a variety of cell types. It facilitates the uptake of these molecules by forming complexes with the nucleic acids, allowing for efficient transfection in cell culture experiments.

Automatically generated - may contain errors

71 protocols using lipofectamine 8000

1

MMP1 Promoter Luciferase Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols
The plasmids with different length or mutant form of MMP1 promoter region and wild-type form of MMP1 promoter region was constructed based on the GV238 backbone. For the luciferase assay, PC cells were plated in 12-well plates and co-transfected with a dual-luciferase reporter and PRKRA overexpression plasmid by Lipofectamine 8000 (C0533, Beyotime, China) according to the manufacturer's instruction. Luciferase activity was measured by Dual-Luciferase Assay (11402ES60, YEASEN, China). The relative luciferase activity was defined as Renilla luciferase activity against Firefly luciferase activity.
+ Open protocol
+ Expand
2

Overexpression of YEATS2 in cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
To construct the YEATS2 overexpression model, a YEATS2 overexpression plasmid (pCMV-hYEATS2) (Miaoling Biotechnology, Wuhan, China) was constructed. Transient transfection was performed using Lipofectamine 8000 (Beyotime Biotechnology, Shanghai, China) when the cell density was 60–70%. Transfection efficiency was determined by Western blotting analysis.
+ Open protocol
+ Expand
3

Transfection of HCCLM3 and SMMC-7721 Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
HCCLM3 and SMMC-7721 cells were transfected with synthetic siRNA oligonucleotides (final concentration:100 nmol/L). Lipofectamine 8000 (Beyotime) was purchased from Gene Pharma (Shanghai, China). The siRNA sequences were as follows: siNoxa: GUAAUUAUUGACACAUUUC; 31siATF4:GCCUAGGUCUCUAGAUGA [31 (link)]; siControl: GUUCUCCGAACGUGUCACGU; siUSP1-1:UCUCCGAACGUGUCACGU [32 (link)]; siUSP1-2:GGUUAAAGUCUGCAACUAATT; siAMPK: CAAUAAGGCUCAUGCACAA; siATG5: CCTGAACAGAATCATCCTTAA.
+ Open protocol
+ Expand
4

Quercetin modulates GSK3β-dependent luciferase

Check if the same lab product or an alternative is used in the 5 most similar protocols
We purchased reporter plasmids of pGL3-Basic-luc or pGL3-Basic- GSK3β-luc from Jinmai biotechnology (Chongqing, China), U87MG cells were seeded in 24-well plates at 5 × 104 cells/well and transfected with 1 μl of Lipofectamine 8000 (Beyotime Biotechnology), and 0.5 μg of reporter plasmids of pGL3-Basic-luc or pGL3-Basic- GSK3β-luc in 25 μl of Opti-MEM. After 24 h of incubation, the cells were treated with quercetin or DMSO for 48 h and then harvested for luciferase assay. The luciferase reporter assay was performed with a Dual Luciferase Reporter Gene Assay Kit (RG027, Beyotime Biotechnology) according to the manufacturer’s protocol. The relative luciferase activity was calculated. Small interfering RNA (siRNA) targeting GSK3β was purchased from Sangon biotechnology (Shanghai, China), U87MG and CHG-5 cells were transfected with siRNA and cultured for 48 h before performing the assays according to the manufacturer’s instructions.
+ Open protocol
+ Expand
5

siRNA Transfection for SDHD and STAT1 Knockdown

Check if the same lab product or an alternative is used in the 5 most similar protocols
Transfection of siRNAs was performed with Lipofectamine 8000 (Beyotime, Beijing, China) according to the suppliers’ protocol. The relevant siRNA sequences were as follows: SDHD-si#1: 5′-GCTCACAATAAGGAAGAAATA-3′; SDHD-si#2: 5′-GCCGAGCTCTGTTGCT TCGAA-3′; STAT1-si#1: 5′-CTGGAAGATTTACAAGATGAA-3′; STAT1-si#2: 5′-CCCTGAAGTATCTGTATCCAA-3′.
+ Open protocol
+ Expand
6

Silencing SGO2 in NSCLC cell lines

Check if the same lab product or an alternative is used in the 5 most similar protocols
We received human NSCLC cell lines (A549 and H1299) from the Chinese Academy of Sciences (Shanghai, China). A549 and H1299 cells were cultivated in Dulbecco's modified eagle medium (Gibco, Grand Island, USA) supplemented with 10% fetal bovine serum (Gibco), penicillin, and streptomycin. These cell lines were maintained at 37 °C and 5% CO2 and then exposed to siRNA (Nanning Gensis Biotechnology Ltd, China) using Lipofectamine 8000 (Beyotime, China) in a serum-free medium after cells were cultured for 24 hours. The siSGO2 sequence used was 5′-GAACACAUUCUUCGCCUATT-3′, while non-targeted siRNAs were used with the sequence 5′-UUCUCCGAACGUGUCACGU-3′.13 (link)
+ Open protocol
+ Expand
7

Plasmid Transfection Using PEI or Lipofectamine

Check if the same lab product or an alternative is used in the 5 most similar protocols
Plasmid transfections were performed using polyethylenimine (PEI, Polyscience, USA) or Lipofectamine 8000 (Beyotime, Shanghai, China). For PEI transfection, the plasmid and PEI were added into serum-free DMEM with vigorous shaking, and the mixture was incubated for 15 min before being added into the cell culture medium. For Lipofectamine 8000 transfection, the plasmid and Lipofectamine 8000 were added into serum-free DMEM, mixed gently with a pipette, and then immediately added to the cell culture medium. The culture medium was replaced every 12–16 h after transfection. Cells were harvested after 36 h.
+ Open protocol
+ Expand
8

Validating the miR-874-3p-ATF3 interaction

Check if the same lab product or an alternative is used in the 5 most similar protocols
The putative binding sites of miR-874-3p with ATF3 mRNA 3′-UTR were predicted using the TargetScan database [28 (link)]. The luciferase reporter vectors (psiCHECK2-Firefly luciferase-Renilla luciferase containing ATF3 wild-type (WT) sequence or mutant (MUT) sequence) were obtained from Guangzhou Geneseed Biotech Co. (Guangzhou, China). Human embryonic kidney (HEK) 293T cells were added to 24-well plates at a density of 1 × 105 cells per well. Subsequently, 1 μg vectors and 100 μL miR-874-3p mimic or mimic NC were cotransfected to HEK-293T cells using 2 μL Lipofectamine 8000 (Beyotime, China). The Luciferase Assay Kit (Promega, Madison, WI, USA) was used to measure the luciferase activity of WT ATF3 or MUT ATF3. The reporter genes' activation degree was calculated between different samples according to the obtained ratio of the relative light unit (RLU) value detected by the Renilla luciferase is divided by the RLU value detected by the Firefly luciferase.
+ Open protocol
+ Expand
9

Immunoprecipitation and miRNA Pulldown Assays

Check if the same lab product or an alternative is used in the 5 most similar protocols
RIP assays were performed with the Magna RIP RNA-Binding Protein Immunoprecipitation Kit (Millipore) following the manufacturer’s instructions. Cells were washed in PBS, lysed in co-IP buffer, and then sonicated and incubated for 3 h at 4 °C. The probe-streptavidin-dynabeads were added, and the mixtures were incubated at 30 °C for 12 h. Next, lysis buffer and proteinase K were added. RNA was extracted according to the TRIzol Reagent and then subjected to qRT-PCR analysis.
MiRNA pull-down assays were performed by transfecting biotinylated miR-345-3p or control probe (Geneseed, Guangzhou, China) into HRVECs with Lipofectamine 8000 (Beyotime, China). The HRVECs lysates were precleared by centrifugation. Then, the remaining lysates and M-280 streptavidin magnetic beads (Invitrogen, USA) were incubated overnight at 4 °C. The biotin-coupled RNA complex bound to the beads was purified using TRIzol reagent. qRT-PCR was conducted to analyze circRSU1 levels in bound fractions.
+ Open protocol
+ Expand
10

Overexpression of circRNAs and TFs in NPCs

Check if the same lab product or an alternative is used in the 5 most similar protocols
The empty vector: pcDNA3.1 + Circ Mini (5607 bp), as well as over-expression vector: pcDNA3.1 + Circ Mini-circ_0040039 (6333 bp) and pcDNA3.1 + Circ Mini- circ_0004354 (5765 bp) were designed and synthesized by Hy cell biotechnology (Wuhan, China). MiR-345-3p mimic and miR-345-3p inhibitor were ordered from Guangzhou Geneseed Biotech Co. (Guangzhou, China). The pcDNA3.1 + FAF1 (7337 bp) and pcDNA3.1 + TP73 were obtained from JIAMAY BIOLAB (Beijing, China). The effects of overexpression were detected by qRT-PCR and western blot experiments. Lipofectamine 8000 (Beyotime, China) was used to transfect plasmids or miR-345-3p or NCs into NPCs following the manufacturer's guidance. After 48 h transfection, NPCs were used to perform the subsequent functional identification experiments.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!