Total RNA was extracted using TRIzol reagent (Invitrogen). Reverse transcription‐PCR was performed with M‐MLV (Promega, Madison, WI, USA) following standard protocols. For the TaqMan‐based real‐time reverse transcription–polymerase chain reaction (RT‐PCR) assays, ABI 7900 HT Sequence Detection system (Applied Biosystem, Foster City, CA) was used. For quantitative PCR of mRNA, the MMP‐2, MMP‐9, and GAPDH primers were purchased from Invitrogen (Life Technology). EzOmics SYBR qPCR kit was purchased from Biomics. Amplification procedure was 94°C for 5 min., followed by 30 cycles at 94°C for 30 sec., 61°C for 45 sec., finally 72°C for 10 min. The primers used were as follows: (i) human MMP‐2, forward primer: 5′‐GACAACGCCCCCATACCAG‐3′, and reverse primer: 5′‐CACTCGCCCCGTGTGTTAGT‐3′; (ii) human MMP‐9, forward primer: 5′‐ACGCAGACATCGTCATCCAGT‐3′, and reverse primer: 5′‐GGACCACAACTCGTCATCGTC‐3′; (iii) human GAPDH, forward primer: 5′‐AAGGTCGGAGTCACCGGATT‐3′, and reverse primer: 5′‐AAGGTCGGAGTCACCGGATT‐3′.
Mmp 2
Manufactured by Thermo Fisher Scientific
Sourced in United States, United Kingdom, China, Germany
The MMP-2 is a lab equipment product designed to measure the activity of matrix metalloproteinase-2 (MMP-2), an enzyme involved in the degradation of the extracellular matrix. It is a tool used in various research applications, including the study of tissue remodeling, cancer metastasis, and inflammatory processes. The MMP-2 product provides researchers with a reliable and accurate method to quantify the levels of this important protease.
Automatically generated - may contain errors
Lab products found in correlation
Mmp 9, by Thermo Fisher Scientific (19 mentions)
Gapdh, by Thermo Fisher Scientific (4 mentions)
Bca protein assay kit, by Thermo Fisher Scientific (4 mentions)
β actin, by Thermo Fisher Scientific (4 mentions)
Trizol, by Thermo Fisher Scientific (3 mentions)
E cadherin, by Thermo Fisher Scientific (3 mentions)
Vimentin, by Thermo Fisher Scientific (3 mentions)
Timp1, by Thermo Fisher Scientific (2 mentions)
Trizol reagent, by Thermo Fisher Scientific (2 mentions)
Tgf β1, by Thermo Fisher Scientific (2 mentions)
Gapdh, by Cell Signaling Technology (2 mentions)
Nanodrop 2000c, by Thermo Fisher Scientific (2 mentions)
β actin, by Merck Group (2 mentions)
Lightcycler 480, by Roche (2 mentions)
Mmp 2, by Merck Group (2 mentions)
Tnf α, by Cusabio (2 mentions)
Interleukin 6 (il 6), by Thermo Fisher Scientific (2 mentions)
N cadherin, by Thermo Fisher Scientific (2 mentions)
Timp 1, by Abcam (2 mentions)
Hrp conjugated secondary antibody, by Thermo Fisher Scientific (2 mentions)
37 protocols using mmp 2
1
Quantitative Analysis of MMP-2 and MMP-9 Expression
2
Immunofluorescence Staining of Frozen Tissue Sections
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For immunofluorescence staining, primary antibodies were diluted in 1 % PBS-bovine serum albumin. Frozen sections were incubated with primary antibodies for agrin (R&D Systems, Minneapolis, MN; #AF550), Hu (Abcam, Cambridge, MA; #96474), CD45 (BioLegend, San Diego, CA; #30F11), anti-GFP (R&D Systems; #AF4240), CD11b (Bio-Rad, Hercules, CA; #M1/70.15), CSF1R (Invitrogen, Waltham, MA; #PA5-25974), F4/80(BM8) (Invitrogen; #41-4801-82), Iba1 (Invitrogen; #PA5-27436), NCAM (Invitrogen; #PA5-78402), Col4 (Abcam; #236640) and S100A1 (Invitrogen; #PA1-932), Ly6G (Abcam; #25377), MPO (R&D Systems; #AF3667), CD45 (BioLegend; #103102), G-SMA (SBC; #65638), TNF (Abcam; #183218), MMP2 (Invitrogen; #PA5-115583), and MMP10 (Invitrogen; #PA5-79677) overnight at 4°C, followed by secondary antibodies (Alexa Fluor 647, 546, and 488 conjugated anti-rabbit immunoglobulin G; Alexa Fluor 647 and 555 conjugated anti-goat immunoglobulin G; Alexa Fluor 488 and 594 conjugated anti-rat; Invitrogen) for 1 hour. Cell nuclei were visualized by DAPI. Sections were covered with aqueous Poly/Mount (Polyscience Inc) and examined with a Zeiss LSM 780 laser-scanning confocal microscope (Zeiss, Oberkochen) or Nikon Eclipse Ti2-E inverted microscope with an Abberior STED super resolution imaging platform. Images were compiled by ImageJ and Adobe Photoshop CS6 (San Diego, CA) software package.
3
Molecular Mechanisms of Transforming Growth Factor-β1 Signaling
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
TGF-β1, Smad2/3, MMP-2, MMP-9, TIMP-1, Collagen I, Collagen III, and Collagen IV primers were synthesized by Invitrogen (Grand Island, NY, USA). TRIzol reagent, PrimeScript™ RT reagent Kit, and SYBR Premix Ex Taq II Kit were provided by Takara Biotechnology Co., Ltd. (Dalian, Liaoning, China). TGF-β1, Smad2/3, P-Smad2/3, Smad4, MMP-2, MMP-9, GAPDH, and anti-rabbit secondary antibodies were purchased from Cell Signaling Technology (Beverly, MA, USA). All other chemicals and reagents were obtained from Sigma Chemicals (St. Louis, MO, USA).
4
Quantifying MMP-2, MMP-9, and PgE2 secretion in MDA-MB-231 cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
MDA-MB-231 cells (2× 105/well) grown to a sub-confluent level in 6-well plate, then cultured for 24 hours in the presence or absence of OSE. The conditioned medium from OSE (0.8 and 1.2 mg/mL) treated cells and untreated cells was collected and the levels of secreted MMP-2, MMP-9 (Invitrogen, Camarillo, CA, USA) or PgE2 (Cayman Chemical, MI, USA) were determined using colorimetric ELISA kitsas per the manufacturer’s instruction. The optical density of each sample was measured using an AMP Platos R 496 microplate reader (AMP Diagnostics, Poland). The proteins present in the conditioned media were concentrated using the Amicon Ultra-0.5 protein purification and concentration column (Millipore) and protein concentration was assayed using the BCA protein assay kit (Thermo Scientific). Levels of the PgE2 and MMPs were normalized to the total protein level in each sample.
5
Quantifying Gene Expression in Cell Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The total RNA was isolated with RNeasy Micro Kit (Qiagen, Hilden, Germany) from in the cool PBS harvested cells hTERT and 12Z (non-treated, treated with 10 µM [Zn(neo)(nif)2], and with 10 µM cisPt for 24 h). The sample concentration and purity was analysed by Nanodrop 2000c (Thermofisher Scientific, Waltham, MA, USA). The RNA samples were transcribed into cDNA by ProtoScript First Strand cDNA Synthesis Kit (New England BioLabs, Ipswich, MA, USA). The real-time PCR was provided using SensiMIX SYBR No-ROX (Bioline, London, UK) and forward/reverse primer of Gapdh (Invitrogen, Carlsbad, CA, USA), Mmp-2 (Invitrogen, Carlsbad, CA, USA), Mmp-9 (Invitrogen, Carlsbad, CA, USA) on Rotor Gene Q.
6
Serum Biomarker Profiling of MMPs and NGAL
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Peripheral whole blood samples were obtained from venipuncture and centrifuged at 1000 × g for 15 min after 30 min of clotting at room temperature. Serum was transferred, aliquoted, and stored at −80 °C until analysis. MMP-9, MMP-2, NGAL and MMP-9/NGAL complex serum levels were determined using commercially available ELISA kits according to the manufacturer’s instructions (MMP-9, NGAL and MMP-9/NGAL complex from R&D, MMP-2 from Invitrogen). Optical density was read on an iMarkTM microplate absorbance reader (Bio-Rad).
7
IHC and IF Staining of MMP-2, MMP-9, Jagged2, Notch
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
In detail, for those of IHC and IF staining, rehydrated paraffin sections were first treated with 3% H2O2 for 30 minutes and incubated with Immuno-Block reagent (BioSB, Santa Barbara, CA, USA) for 30 minutes at room temperature. Sections were then incubated with primary antibodies specifically against MMP-2 (1:200, Invitrogen, CA, USA), MMP-9 (1:200, Invitrogen, CA, USA), Jagged2 (1:100, Abcam, Cambridge, UK) and Notch (1:150, Abcam, Cambridge, UK), while sections incubated with the use of irrelevant antibodies served as controls. Immunoreactive were visualized by enhanced DAB kit (Abcam).
8
Quantifying Atherosclerotic Plaque Stability
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To measure the intraplaque contents of smooth muscle cells, macrophages, CD31, endomucin, monocyte chemoattractant protein (MCP)-1, and matrix metalloproteinase (MMP)-2, sections were reacted with primary antibodies against α-smooth muscle actin (α-SMA, Abcam, Cambridge, UK), monocyte/macrophage (MOMA-2, Abcam), CD31 (Abcam), endomucin (Abcam), MCP-1 (Abcam), and MMP-2 (Invitrogen) at 4°C overnight. Then the sections were reacted with secondary antibodies (Zhongshan Golden Bridge Bio-technology, Beijing, China) at 37°C for 30 minutes. The intraplaque macrophages, smooth muscle cells, MMP-2, endomucin, MCP-1and CD31 contents were quantified by Image-Pro Plus 6.0 software. Atherosclerotic plaque instability index was calculated according to the standard formula: (Oil Red O+ area plus MOMA-2+area) / (α-SMA+ area plus collagen+ area) 12 (link)-13 (link).
9
Western Blot Analysis of Protein Targets
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cells were washed twice with PBS and lysed in cell lysis buffer (150 mM NaCl,10 mM Tris, 0.2 %TritonX-100, 0.3 %nonylphenoxy-polyethoxyethanol-40, 0.2 %mM Na3VO4, protease inhibitor cocktail). The cell lysates were centrifuged and the protein concentration was measured as previously mentioned. Each sample was separated by electrophoresis using 8 % SDS-PAGE gel and analyzed by Western blotting using the following antibodies: primary rabbit anti-human MMP-9 (Novusbio, Colorado, USA), and β-HK2 (Cell signaling, Beverly, Massachusetts, USA), as well as primary mouse anti-human HIF-1α (eBioscience, CA, USA), MMP-2 (Invitrogen, CA, USA), caspase-7 (Novusbio, Colorado, USA), and β-Actin (Sigma-Aldrich Chemical Co., USA). Horseradish peroxidase linked to the corresponding secondary antibody was used at 1:5000 dilution. The membrane was visualized by exposure to Kodak XAR film. For the quantitative analysis, the mean intensity of each band (mean pixel), was compared with β-Actin band using with Scion Image Beta 4.0.2 (Scion Co., MD, U.S.A.) software.
10
Quantifying MMP-2 and MMP-9 Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Typically, 15 to 30 μg of total cellular protein were loaded in polyacrylamide gel (Bio Rad Laboratories) and separated by SDS-PAGE. Thereafter, proteins were transferred onto nitrocellulose membrane (Sigma-Aldrich) using Mini Trans-Blot BioRad (Bio Rad Laboratories). Before to be incubated overnight at 4 °C with specific primary antibodies (MMP-2 and mMP-9, Invitrogen, 436000; MA5-15886 Waltham, MA, USA), membranes were blocked in no-fat milk (5% w/v) for 1 h. The day after, Horseradish Peroxidase (HRP) goat anti-rabbit or anti-mouse antibodies were added to the membranes for 1 h at room temperature. TBS Tween-20 (Thermo Fisher Scientific) was used to wash three times the membranes before and after each incubation procedure. Enhanced ChemiLuminescence (ECL) (Euroclone) was employed to detect HRP secondary antibodies signal. To conclude, protein bands were detected with Chemi Doc XRS (Bio-Rad, Hercules, CA, USA).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!