Collagen 1

HFL1 human fibroblast cells were purchased from PROCELL and cultured in Ham's F12K medium supplemented with 10% fetal bovine serum (FBS), 100 U/ml penicillin, and 100 μg/ml streptomycin. The cells were maintained at 37 °C in a humidified atmosphere containing 5% CO2. To silence hsa-circ-0044226, 40,000 HFL1 cells were seeded in each well of a 6-well plate and cultured in Ham's F12K medium supplemented with 10% FBS. The cells were then activated with 10 ng/ml TGF-β1 (Novoprotein) for 24 h. Subsequently, HFL1 cells were transfected with hsa-circ-0044226-specific siRNA (5’TGAGGTGTTGTACATGCATTATAA3’) or scramble RNA using Lipofectamine™ 3000 Transfection Reagent (Thermo Fisher Scientific, Cat#L3000-015) following the manufacturer's instructions. After 24 h, the cells were collected for RT-qPCR and Western blot analyses, according to the manufacturer's instructions. The primary antibodies used for Western blotting included α-SMA (Boster Biological Technology, Cat#BM0002), fibronectin (Cell Signaling Technology, Cat#26836S), collagen I (Cell Signaling Technology, Cat#84336), and GAPDH (Abclonal, Cat#A19056). The secondary antibodies used were goat anti-mouse IgG-HRP (Abclonal, Cat#AS003) and goat anti-rabbit IgG-HRP (abcam, Cat#ab6721).

Proteins were extracted from liver tissues and cells with ice-cold lysis buffer (50 mM Tris, 0.1% sodium dodecyl sulfate, 300 mM Nacl, 1% Triton-100, 1% sodium deoxycholate). Proteins were treated with SDS-PAGE and transferred to polyvinylidene fluoride (PVDF) membranes (Millipore, MA, USA). The membranes were incubated with β-catenin, SOX9, α-SMA, Collagen I, TIMP-1, β-actin rabbit mAbs (Cell Signaling Technology, MA, USA), and TGF-β1 rabbit mAbs (Abcam, Cambridge, UK) overnight at 4°C after blocking, followed by secondary goat anti-rabbit IgG (Cell Signaling Technology, MA, USA) at 37°C for 1 h. β-actin served as an internal control.

Proteins were extracted from liver tissues and cells with ice-cold lysis buffer (50 mM Tris, 0.1% sodium dodecyl sulfate, 150 mM Nacl, 1% Triton-100, 1% sodium deoxycholate). The following primary antibodies were used to incubate membranes: HLF (Abcam, Cambridge, MA, United States), HIF-1α, α-SMA, Collagen-I, TIMP-1, TGF-β, p-Smad2, Smad2, p-Smad3, Smad3, β-actin rabbit mAbs (Cell Signaling Technology, MA, United States). The reactions were detected with HRP-conjugated goat anti-rabbit immunoglobulin G (IgG) (Cell Signaling Technology, MA, United States) secondary antibodies.

Total protein was extracted from the heart tissues and H9C2 cells. After protein concentration measurement, these proteins were separated by SDS-PAGE and subsequently transferred to PVDF membranes. Then, the filter membranes were incubated overnight at 4 °C with the primary antibody (Calumenin from Abcam, Collagen I and Collagen III from Cell Signaling). The membranes were further incubated with corresponding secondary antibody for two hours at room temperature and detected using the enhanced chemiluminescence (ECL) system. β-Actin was used as a loading control. The bands were analyzed by the quantity one.

The Bradford method (Bio-Rad Lab., Hercules, CA, USA) was used to measure protein concentration. Protein samples (40 μg/lane) were resolved by SDS polyacrylamide gel electrophoresis (SDS-PAGE) and transferred onto polyvinylidene difluoride (PVDF) membrane (Millipore, Bedford, MA, USA, 0.45 μm pore size). Block the PVDF membranes for overnight at 4°C with blocking buffer (BlockPRO, Visual Protein Biotechnology, Taipei, Taiwan) and then incubated with the primary antibodies including AT₁R (1:1000, Novus Biologicals, Littleton, CO), FGF23, LOX-2, TGF-β, CTGF, p-Smad 2/3, MMP-2, MMP-9, TIMP-1, TIMP-2, uPA, collagen I and β-actin (1:1000, Cell Signaling Technology, Danvers, MA, USA) at overnight 4°C. Next, the PVDF membranes were treated in the second antibody solution (Jackson ImmunoResearch Laboratories, West Grove, PA, USA) and diluted 5000-fold in a TBS buffer. The protein bands were detected by ECL western Blotting luminal Reagent (Millipore Corporation, Billerica, MA, USA) and the intensities of bands were quantified using a bioimaging analyzer (LAS-3000; Fujifilm Corporation, Tokyo, Japan). The β-actin was used as the internal reference.

Tissue sections were removed oxidase and then subjected to antigen repair. The sections were blocked for 30 min at room temperature using 5% bovine serum albumin followed by incubation with the following primary antibodies at 4°C overnight: caspase-1 (1:200) (Cell Signaling Technology,MA, United States), IL-1β (1:100) (Cell Signaling Technology,MA, United States), TGF-β1 (1:200) (Cell Signaling Technology, MA, United States), GSDMD (1:100) (Bioss, Beijing, China), collagen I (1:200) (Cell Signaling Technology, MA, United States) and collagen III (1:200) (Cell Signaling Technology, MA, United States). Next day, the samples were then washed three times for 5 min each using PBST, and the corresponding secondary antibodies were added followed by incubation for 1 h at room temperature. The sections were then stained with diaminobenzidine, and the nuclei were stained with hematoxylin. The sections were then sealed using neutral gum. A fluorescence microscope under white light conditions (Nikon 80i, Japan) was used for imaging.