Lentiviral gene transfer vector pLKO-Tet-On, packaging (psPAX2) and envelope (pMD2.G) plasmids were purchased from Addgene (Cambridge, USA). One pair of control (scrambled) shRNA and two pairs of oligonucleotides targeting different regions of the PRMT5 gene (target sequence #1: 5'-GGGACTGGAATACGCTAATTG-3', #2: 5'-GGTC TTCCAGCTTTCCTGCTG-3') were synthesized, annealed, and inserted into pLKO-Tet-On at AgeI and EcoRI sites. Viruses were generated according to methods described by Wiederschain et al. [27 (link)]. Glioma cell lines (U373MG and LN229) were plated in 6-well plates and grown to 60 % confluency before lentiviruses were introduced at a multiplicity of infection (MOI) of 0.5. Cells were incubated with the viruses for 24 h before the medium was replaced with puromycin (1 µg/ml) containing medium. Puromycin selection was completed after 3 days of treatment and the resistant cells were used for further experiments. Doxycycline (200 ng/ml) inducible knockdown of PRMT5 was examined at different time points after exposure to doxycycline.
Plko tet on
Manufactured by Addgene
Sourced in United States
The PLKO-Tet-On is a plasmid that allows for inducible gene expression. It contains a Tet-On system, which enables the expression of a gene of interest in the presence of doxycycline.
Automatically generated - may contain errors
Lab products found in correlation
Hct116 p53, by American Type Culture Collection (2 mentions)
Hct116 wildtype wt, by American Type Culture Collection (2 mentions)
Hek293t, by American Type Culture Collection (2 mentions)
Pspax2, by Addgene (1 mentions)
Pmd2 g, by Addgene (1 mentions)
Pspax2, by Merck Group (1 mentions)
Pspax2, by Promega (1 mentions)
Pmd2 g, by Merck Group (1 mentions)
Pmd2 g, by Promega (1 mentions)
Genelute hp plasmid midiprep kit, by Merck Group (1 mentions)
Fugene 6, by Promega (1 mentions)
Plvx dsred monomer n1, by Takara Bio (1 mentions)
Mission lentiviral packaging system, by Merck Group (1 mentions)
Plko 1, by Addgene (1 mentions)
Plenti cmv gfp puro plasmid, by Addgene (1 mentions)
Plhcx, by Takara Bio (1 mentions)
P3xflag cmv 10 vector, by Merck Group (1 mentions)
Q5 site directed mutagenesis kit, by New England Biolabs (1 mentions)
Mission lentiviral system, by Merck Group (1 mentions)
P3xflag cmv 7, by Merck Group (1 mentions)
10 protocols using plko tet on
1
Lentiviral Knockdown of PRMT5 in Glioma Cells
2
Lentiviral Vector Production and Transduction
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All plasmids were purified utilizing a GenElute HP Plasmid Midiprep Kit (Sigma) after transformation using DH5α cells with ampicillin. Lentiviral packing plasmids, pMD2.G and psPAX2, were purchased from Sigma. LentiCRISPRv2 was obtained as a gift from Dr. Anil Rustgi (Columbia University, New York, NY, USA). The single-guide RNA (sgRNA) sequence targeting the MEN1 gene (Supplemental Table S1 ) was cloned into the lentiCRISPRv2 vector as previously described [6 (link)]. shRNA plasmids for LXRα were obtained from the University of Pennsylvania Perelman School of Medicine High-Throughput Screening Core (Philadelphia, PA, USA), all of which were derived from a pLKO.1-puromycin backbone, with sequences for the LXRα shRNAs listed in Supplemental Table S1 . The pLKO-Tet-On was obtained from Addgene and used to generate doxycycline-inducible menin shRNAs using two validated menin shRNA sequences (Supplemental Table S1 ) as previously described [23 (link),24 (link)]. To produce lentivirus, 293T cells were transfected with pMD2.G, psPAX2, and the plasmid of interest using Fugene 6 (Promega, Madison, WI, USA) according to the manufacturer’s instructions. After collecting and filtering the virus, cells were then transduced in the presence of 4 μg/mL polybrene (hexadimethrine bromide). Twenty-four hours after completion of transduction, cells were then selected with puromycin for 72 h.
3
Inducible Knockdown of HSP60 in ESCs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
shHSP60 was expressed using the inducible lentiviral vector pLKO-Tet-On (Addgene, Cambridge, MA, USA). The vector sequence encoding HSP60 short hairpin RNA (shRNA) is as follows: 5′-CCGGCACTGTTCTGGCACGATCTCTCGAGAGATCGTGCCAGAACAGTGTTTTT-3′. Non-targeting shRNA (pLKO-puro/non-targeting; Addgene) was used as a negative control. We produced viral particles in HEK293FT cells and used the viral particles to transduce R1 ESCs, which were subsequently cultured in the presence of 1 μg ml−1 puromycin. HSP60 expression was induced using 2 μg ml−1 doxycycline.
4
Lentiviral Transfection of Aurora-A and GFP shRNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Plasmid pLVX-DsRed-N1-Monomer (Clontech) expressing Aurora-A was from Dr. Feimeng Zheng, Sun Yat-sen University. The shRNA sequences against GFP (Sence-5′-GCAAGCTGACCCTGAAGTTCAT, Antisense-5′-ATGAACTTCAGGGTCAGCTTGC) and Aurora-A (Sence-5′-CACATACCAAGAGACCTACAA, Antisense-5′-TTGTAGGTCTCTTGGTATGTG) were cloned into pLKO-Tet-On (Addgene). Lentiviruse was produced in 293T cells as described earlier
[25 (link)].
[25 (link)].
5
Constitutive and Inducible Id1 shRNA Protocols
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Oligonucleotides for constitutive Id1 shRNA (Id1sh) (TRCN0000071436) were: forward 5’-CCG GGCGAGGTGGTACTTGGTCTGTCTCGAGACAGACCAAGTACCACCTCGCTTTTTG-3’: reverse 5’-AATTCAAAAAGCGAGGTGGTACTTGGTCTGTCTCGAGACAGACCAAGTACCACCTCGC-3’ (Thermo, Waltham, MA, USA). Oligonucleotides were annealed and cloned into the lentiviral plasmid pLKO.1 (plasmid #8453, Addgene). pLKO.1-scramble (pLKO-Sc, plasmid #1864, Addgene) was used as control. Oligonucleotides for doxycycline-inducible Id1 shRNA (i-Id1sh) (TRCN0000019029) were: forward 5′-CCGGCCTACTAGTCACCAGAGACTTCTCGAGAAGTCTCT GGTGACTAGTAGGTTTTTG-3′; reverse 5′-AATTCAAAAACCTACTAGTCACCAGAGACTTCTC GAGAAGTCTCTGGTGACTAGTAGG-3′ (Sigma-Aldrich). An inducible GFP shRNA (i-GFPsh) was used as control. Oligonucleotides were annealed and cloned into the lentiviral plasmid pLKO-Tet-On (plasmid #21915, Addgene). The Mission lentiviral packaging system (Sigma-Aldrich) was used to generate the lentiviral particles, and cells were infected as previously described21. Selection of transfected clones was carried out with puromycin (2 µg/mL).
6
Overexpression and Knockdown Vectors for ORMDL3 and ATF6
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To construct the overexpression vector of ORMDL3, mouse ORMDL3 gene coding sequence was synthesized according to the gene sequence (NM_025661) in the GenBank and inserted into the vector pLenti-GFP-IRES (provided by Novobio Shanghai, China) via NheI and AscI restriction endonuclease sites. To generate the knockdown vector of ORMDL3, shRNA was prepared by synthesizing and annealing two oligonucleotides (Forward primer 5’-CACCGCCAAGTATGACCAAGTCCATTCGA AAATGGACTTGGTCATACTTGG-3’ and Reverse complementary primer 5’-AAAACCAAGTATG ACCAAGTCCATTTTCGAATGGACTTGGTCATACTTGGC-3’) and then cloned into the vector pLenti-U6-shRNA-GFP (provided by Novobio Shanghai, China) via two BsmBI sites. The knockdown vector of ATF6 was constructed by using designed shRNA oligonucleotides (Forward primer 5’-CCGGGCACTTTGATGCAGCACATGACGAATCATGTGCTGCATCAAAGTGCTTTTT-3’ and Reverse complementary primer 5’-AATTAAAAAGCACTTTGATGCAGCACATGATTCGTCATGT GCTGCATCAAAGTGC-3’) which were then inserted into an inducible knockdown system pLKO-Tet-On (Addgene 21915) via AgeI and EcoRI sites. All the constructs were verified by Sanger sequencing.
7
Lentiviral plasmid transfection in cell lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
HCT116 wildtype (WT), HCT116 p53–/–, and HEK293T were purchased from ATCC. Lentiviral plasmid empty backbone pLKO-Tet-On was obtained from Addgene (21915). pLenti-CMV-GFP-Puro plasmid was obtained from Addgene (17448). Plasmid p3XFLAG -CMV-7.1 was obtained from Sigma (E7533).
8
Cloning and Expression of C19orf43
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The shRNA plasmids against C19orf43 were generated by cloning hairpins targeting the following sequences into the pLKO.1 puro Vector: C19orf43#1 against the 3′ UTR 5′- GCCTCGTGAGACTTCATAGAA-3′ and C19orf43#4 against the coding sequence 5′-AGACGGAGGATGAGGTATTAA-3’. For dox-i C19orf43 the same hairpin as for #1, the 3′ UTR 5′- GCCTCGTGAGACTTCATAGAA-3′, was cloned into pLKO-Tet-On (Addgene #21915).
RNaseH1 plasmids containing C-terminally myc-tagged human full length RNaseH1, wild type (WT) or catalytically dead (CD) (D145A), cloned into the retroviral Vector pLHCX (Clontech), were kindly provided by Claus Azzalin.43 (link) TNKS1 plasmid was described previously.65 (link) The C19orf43.WT plasmid is comprised of an N-terminal 3x FLAG tag followed by human full length C19orf43 cloned into the p3XFlag-CMV-10 Vector (Sigma). C19orf43.R7G was obtained by mutating the arginine at position 7 to glycine and C19orf43.R106G was obtained by mutating the arginine at position 106 to glycine. Mutagenesis was performed using Q5 Site-Directed Mutagenesis Kit (NEB) according to the manufacturer’s instructions. For expression in E. coli, C19orf43 was cloned into the pET-22b Vector (Novagen) with a C-terminal His tag and expressed without the pelB leader sequence.
RNaseH1 plasmids containing C-terminally myc-tagged human full length RNaseH1, wild type (WT) or catalytically dead (CD) (D145A), cloned into the retroviral Vector pLHCX (Clontech), were kindly provided by Claus Azzalin.43 (link) TNKS1 plasmid was described previously.65 (link) The C19orf43.WT plasmid is comprised of an N-terminal 3x FLAG tag followed by human full length C19orf43 cloned into the p3XFlag-CMV-10 Vector (Sigma). C19orf43.R7G was obtained by mutating the arginine at position 7 to glycine and C19orf43.R106G was obtained by mutating the arginine at position 106 to glycine. Mutagenesis was performed using Q5 Site-Directed Mutagenesis Kit (NEB) according to the manufacturer’s instructions. For expression in E. coli, C19orf43 was cloned into the pET-22b Vector (Novagen) with a C-terminal His tag and expressed without the pelB leader sequence.
9
Overexpression and Knockdown of MSI2 and EIF3A
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The human MSI2 ORF (NM_13892.2) was PCR amplified from cDNA and cloned into the BamHI and EcoRI sites of the pBABE-puro retroviral vector with an N-terminal FLAG tag. Stable lentiviral vectors expressing shRNA targeting MSI2 and control shRNAs were obtained from Sigma Aldrich (Mission lentiviral system, based on the pLKO.1 vector; Clone details are provided in Supplementary Methods) and confirmed for their knockdown activity by RT-PCR and Western blotting. Lentiviral vector pLKO-Tet-On (Addgene Plasmid #21916) was used to generate inducible knockdown clones of MSI2 and EIF3A (19) (for the sequence see Supplementary Methods). Retroviral and lentiviral vectors were produced by the co-transfection of respective pro-viral plasmids with appropriate helper and envelope plasmids and transduced into K562 cells as previously described (18) .
10
Cell Lines and Plasmids Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
HCT116 wildtype (WT), HCT116 p53-/-, and HEK293T were purchased from ATCC. Lentiviral plasmid empty backbone pLKO-Tet-On was obtained from Addgene (21915). Plasmid p3XFLAG -CMV-7.1 was obtained from Sigma (E7533).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!