PCR amplification of the ITS region was conducted in 50 µL reaction volumes containing the following reagents (and their final concentrations): Fisher Taq Buffer B (1×), MgCl2 (2.5 mM), dNTPs (0.25 mM), ITS 5* forward primer (1 µM) (Liston et al., 1996 ), ITS 26S‐25R reverse primer (1 µM) (White et al., 1990 ), Fisher Taq polymerase (0.4 U) and 80 ng of DNA. Thermal cycling conditions began with a 94°C denature (2 min), followed by 35 cycles of 94°C (1 min), 50°C (45 s), and 72°C (45 s), ending with a final extension at 72°C (10 min). Polymerase chain reaction (PCR) products were then visualized on a 0.8% agarose gel stained with ethidium bromide. PCR products greater than or equal to 5 ng/µL were sent directly to sequencing on an ABI 3730 DNA sequencer (Sequetech, Santa Clara, California, USA) following the suggested BigDye protocol (Applied Biosystems, Foster City, California, USA). PCR products less than 5 ng/µL were gel purified (QIAquick gel extraction kit, Qiagen, Hilden, Germany), then used as template DNA for a second round of PCR amplification under the same conditions as indicated above. Each sample was directly sequenced in both the forward and reverse directions with the same primers as those used in PCR.
Big dye protocol
Manufactured by Thermo Fisher Scientific
Sourced in United States
The Big Dye protocol is a laboratory technique used for DNA sequencing. It involves the use of fluorescently labeled nucleotides that are incorporated into the DNA sequence during the sequencing process. The resulting labeled DNA fragments are then separated by size using capillary electrophoresis, and the fluorescent signals are detected and analyzed to determine the DNA sequence.
Automatically generated - may contain errors
Lab products found in correlation
Lipofectamine crisprmax cas9 transfection reagent, by Thermo Fisher Scientific (2 mentions)
Kapa2g taq polymerase, by Roche (2 mentions)
3130xl genetic analyzer, by Thermo Fisher Scientific (2 mentions)
Qiaquick gel extraction kit, by Qiagen (1 mentions)
Proteinase k, by Thermo Fisher Scientific (1 mentions)
Mammalian genomic dna miniprep kit, by Merck Group (1 mentions)
Cas9 protein, by Thermo Fisher Scientific (1 mentions)
Lysis solution, by Merck Group (1 mentions)
Neutralization buffer, by Merck Group (1 mentions)
L3289, by Merck Group (1 mentions)
Qiaamp dna blood mini kit, by Qiagen (1 mentions)
6 protocols using big dye protocol
1
ITS Region PCR Amplification Protocol
2
HPV Genotyping from Cervical Samples
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA from the cervical samples was extracted using the proteinase K [Invitrogen, CA, USA] protocol and subjected to PCR using the degenerate primers MY09 and MY11 for amplification of the HPV L1 gene as previously described [20] (link). The PCR product was purified by conventional phenol-chloroform procedure prior sequencing using the Big Dye protocol (Applied Biosystems, SP, Brazil), in accordance with the manufacturer’s description. The chromatograms were firstly viewed using the Mega 5.0 software [21] (link) in order to evaluate the quality of the sequence and comparisons were made with the reference sequences deposited in the GenBank database (http://www.ncbi.nlm.nih.gov ), for viral typing identification. The viral isolates were classified in low-risk (types 6, 11, 61, 54, 62, 71, 72, 81, 84, 85, 86) or high-risk (types 16, 18, 31, 33, 45, 52, 53, 56, 58, 59, 66, 69, 70, 82) [22] (link), according to their known capacity in developing cancer.
3
Generation of Ndufs3 Knockout B16-F10 Cell Line
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
CRISPR/Cas9 system was used to introduce a frameshift mutation in Ndufs3 gene in B16-F10 murine melanoma cell line. In detail, Cas9 protein (Invitrogen #A36497) was transfected following manufacturer’s instructions using Lipofectamine CRISPRMAX Cas9 Transfection Reagent (Invitrogen #CMAX00015) together with synthetic RNA guides designed by Deskgen and purchased from Synthego. Exon 3 targeting guide TTGTGGGTCACATCACTCCG with PAM sequence GGG was used. Cells were split 48 hours after transfection and DNA was extracted using Mammalian Genomic DNA Miniprep Kit (Sigma-Aldrich #G1N350). Non-homologous repair efficiency was evaluated by Sanger Sequencing using KAPA2G Taq polymerase (Kapa Biosystems #KK5601) and Big Dye protocol (Life Technologies #4337451). In particular, 61°C annealing temperature was used for the PCR reaction, with primers forward CTGTAACTCCAGTCTCAGGGA and reverse CACACTGCAGGGATCACTTG. Manual clonal selection was performed in order to identify the cells with frameshift Ndufs3 mutations, leading to the generation of a pool of clones carrying the homozygous c.148A>G and c.150_151insCT mutations. DNA extraction from 96-well plates was performed using 8 μL of Lysis Solution (Sigma-Aldrich #L3289) and 80 μL of Neutralization Buffer (Sigma-Aldrich #N9784) per sample, following manufacturer’s instructions.
4
CRISPR-Mediated NDUFS3 Knockout
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The CRISPR/Cas9 system was used to insert a frameshift mutation in the NDUFS3 gene in SKOV3 and OVSAHO cell lines. Cas9 protein was transfected following the manufacturer’s instructions using Lipofectamine CRISPRMAX Cas9 Transfection reagent (Invitrogen #CMAX00008) together with synthetic RNA guides designed and purchased from IDT. Exon 2 targeting guide TGTCAGACCACGGAATGATG was used. Non-homologous repair efficiency was evaluated by Sanger sequencing using KAPA2G Taq Polymerase (Kapa Biosystems #KK5601) and the Big Dye protocol (Life Technologies #4337451). PCR for NDUSF3 was performed using the primers forward 5’-TCTCAAGGTGCTTCAGGGAG-3’ and reverse 5’-GAAACAAGTCTGCCCACTCC-3’. Clonal selection was carried out to select cells with frameshift NDUFS3 mutations. DNA extraction was performed following the manufacturer’s instructions using 8 µL of lysis buffer (Sigma–Aldrich #L3289) and 80 µL of neutralization buffer (Sigma Aldrich #N97784) per sample in a 96-well plate.
5
Molecular Identification of Leishmania Species
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Leishmania genus 18S real time polymerase chain reaction (PCR) was performed as previously described [21 (link)]. Species identification included analysis of the internal transcribed spacer 1 (ITS1), ITS2, cysteine proteinase B (CPB), heat shock protein 70 (HSP70), and mannose phosphate isomerase (MPI) targets by PCR, restriction fragment length polymorphism (RFLP) analysis, and Sanger sequencing [22 (link), 23 (link)]. As PCR-RFLP analysis of the ITS1 region can only differentiate L. V. braziliensis from the other species within the Viannia subgenus (L. V. guyanensis, L. V. peruviana, L. V. panamensis, L. V. lainsoni), both PCR-RFLP and sequencing analysis of the CPB, HSP70, MPI and ITS2 regions were used to differentiate species within the Leishmania Viannia sub-genus. Purified PCR product was used for Sanger sequencing as per Big Dye protocol (Life Technologies). Sequence products were purified and analyzed using the Applied Biosystems 3130xl Genetic Analyzer. Data were standardized using the Sequencing Analyzer program and the Basic Local Alignment Search Tool (BLAST) engine was used to analyze sequences.
6
Molecular Identification of Leishmania Species
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DNA was extracted using QIAamp DNA Mini Kit Blood (Qiagen, Germantown, MA, USA). Leishmania genus 18S real-time polymerase chain reaction (PCR) was performed as previously described.20 (link)
Species identification included analysis of the internal transcribed spacer 1 (ITS1), ITS2, CPB, HSP70, and MPI targets by PCR, restriction fragment length polymorphism (RFLP) analysis, and Sanger sequencing.21 (link),22 (link) PCR-RFLP analysis of the ITS1 region can only differentiate L. V. braziliensis from the other species within the Viannia subgenus (L. V. guyanensis, L. V. peruviana, L. V. panamensis, L. V. lainsoni). Thus, PCR-RFLP and sequencing analysis of the CPB, HSP70, MPI, and ITS2 regions were required to differentiate species within the Leishmania Viannia subgenus and to provide a confirmation of the species identified in the initial ITS1 assay. Purified PCR product was used for Sanger sequencing as per Big Dye protocol (Life Technologies, Carlsbad, CA, USA). Sequence products were purified and analyzed using the Applied Biosystems 3130xl Genetic Analyzer. Data were standardized using the Sequencing Analyzer program and the BLAST search engine was used to analyze sequences.
Species identification included analysis of the internal transcribed spacer 1 (ITS1), ITS2, CPB, HSP70, and MPI targets by PCR, restriction fragment length polymorphism (RFLP) analysis, and Sanger sequencing.21 (link),22 (link) PCR-RFLP analysis of the ITS1 region can only differentiate L. V. braziliensis from the other species within the Viannia subgenus (L. V. guyanensis, L. V. peruviana, L. V. panamensis, L. V. lainsoni). Thus, PCR-RFLP and sequencing analysis of the CPB, HSP70, MPI, and ITS2 regions were required to differentiate species within the Leishmania Viannia subgenus and to provide a confirmation of the species identified in the initial ITS1 assay. Purified PCR product was used for Sanger sequencing as per Big Dye protocol (Life Technologies, Carlsbad, CA, USA). Sequence products were purified and analyzed using the Applied Biosystems 3130xl Genetic Analyzer. Data were standardized using the Sequencing Analyzer program and the BLAST search engine was used to analyze sequences.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!