Thermoscript rt pcr

The analysis of particular mRNA was performed by RT-PCR as described previously (37 (link)). cDNAs were synthesized from 1.5 μg of RNA using the ThermoScript RT-PCR instrument for first-strand synthesis (Invitrogen). Quantitative PCR (qPCR) reactions were performed using a cDNA mix with primers in a final volume of 25 μl in an Applied Biosystems Quant Studio 6-Flex Real-Time PCR instrument (Norwalk, CT, USA). The parameter of the cycle was as follows: 50°C for two minutes, one step of denaturation at 95°C for ten minutes, and 40 cycles of denaturation at 95°C for ten seconds, followed by annealing and elongation at 60°C. The ΔΔCt analysis normalized each transcript’s relative expression level to that of GAPDH. Table S1 of the Supplemental Information presents the primer sequences used for qPCR.

Total RNA was prepared from all samples using TRIZOL® (Invitrogen, Carlsbad, CA) and further purified using RNeasy columns (Qiagen, GmbH) according to the manufacturer’s instructions. For qPCR assays, we reverse-transcribed total RNA (2 µg) treated with DNase I (Ambion) using oligo (dT) 20 primer with ThermoScript TM RT-PCR (Invitrogen). We carried out PCR reactions in a final volume of 16 µL containing 10x PCR buffer (Ecogen), 50 mM of MgCl₂, 2 mM of dNTP, 1 µM of each primer and 3U of EcoStart DNA polymerase (Ecogen). 100 ng of cDNA were used for each PCR amplification. We also carried out PCR with GAPDH (22 cycles) to ensure cDNA quality and loading accuracy. Three biological replicates were included for each gene. Primer sequences are listed in Supplementary Table S5.

RT-qPCR was performed using total RNA from the central tissues of eight (Numbered 1–8) patients with normal brain tissues (1–2), WNT/SHH (3–5), and Group 3 (6–8) MB. Total RNA was extracted using TRI Reagent (Molecular Research Center, Inc.) according to the manufacturer’s protocol, and cDNA was synthesized using random hexamer and oligo (dT) primers using Thermo ScriptTM RT-PCR (Invitrogen). The gene-specific primers employed were purchased from the NDT Corporation. PCR was performed for 40 cycles of 95 °C for 15 s and 60 °C for 30 s. H-actin was amplified as a control (Forward: ACCCTGAAGTACCCCATCGAG; reverse: AGCACAGCCTGGATAGCAAC). Specific expression of MFAP2 and GRM8 in cell lines was established using total RNA obtained from tumor tissues and amplified with primers for each one (MAGP: Forward, CAGTCCCAGCAGCAAGTCCA and Reverse, AAGCAGACCTCGTTGAGACAC; GRM8: Forward, ACCTGCATCATTTGGTTAGCTT, and Reverse, AAACCTTGGGCATATAGAGCA) using SYBR Green PCR Master Mix (ThermoFisher Scientific).