Hnrnpc

Firstly, total RNA was isolated from transfected cells by TRIzol method. Then RNA was reverse-transcribed into cDNA using cDNA reverse transcription kit (takara, Japan). Finally, fluorescence quantitative PCR was performed using designed specific primers and SYBR green I fluorescent dye detection. The PCR primer sequence is HNRNPC-F: GTCCCCTCTACTCAGTTCCTCAT, HNRNPC-R: TGGAAGAAGATCCCCGTTGT. A total of 30 cycles are set (denaturation: 95°C/2 minutes, annealing: 50°C/2 minutes, extension: 60°C/1 minute).
We used RIPA Lysis Buffer to prepare cell lysates from transfected cells. We placed the lysate on ice for a few minutes and pipetted to fully lyse the cells. Then, we transferred it to a 1.5 mL centrifuge tube and shook vigorously for 30 seconds. Finally, it was centrifuged at 12,000 rpm at 4°C for 15 minutes, and we aspirated the supernatant for subsequent electrophoresis. The electrophoresis was run on an SDS-PAGE gel. The primary antibody was HNRNPC (rabbit source, Abcam), and the secondary antibody was goat anti-rabbit IgG (sigma).

Equal amounts of each protein diluted in 5 × sodium dodecyl sulfate (SDS) loading buffer (Beyotime, Shanghai, China) were separated using SDS–polyacrylamide gel electrophoresis (PAGE) and subsequently transferred to polyvinylidene fluoride (PVDF) membranes (Millipore, Massachusetts, USA). After being blocked at room temperature for 1 h, the membranes were incubated with primary antibodies against GAPDH (1:1000, Cell Signaling Technology, Massachusetts, USA, 5174), p21 (1:1000, Abcam, Cambridge, UK, 109,520), p53 (1:1000, Cell Signaling Technology, 48,818), p16 (1:1000, Abcam, 51,243), SERPINE2 (1:1000, Abcam, 134,905), YBX3 (1:2000, Bethyl, Montgomery, USA, A303-070A), β-Tubulin (1:1000, Cell Signaling Technology, 2128), PCNA (1:1000, Abcam, 29), Histone3 (1:1000, Abcam, 176,842), ubiquitin (1:1000, Abcam, 134,953), HNRNPC (1:1000, Abcam, 133,607), YBX1 (1:1000, Proteintech, Rosemont, USA, 20,339–1-AP), and ZO-1 (1:1000, Proteintech, 21,773–1-AP) overnight at 4 °C. The membranes were washed 3 times, incubated with corresponding horseradish peroxidase (HRP)-conjugated secondary antibodies (1:3000, BOSTER, California, USA, BA1050, BA1054) for 1 h at room temperature and then washed 3 times with TBST. Specific immunoreactive bands were detected using Immobilon Western Chemiluminescent HRP Substrate (Millipore). The mean intensity ratio was analyzed by ImageJ 1.4.

Western blots were done as previously described (16 (link)) using the following antibodies: hnRNP L (Abcam, Ab6106), CELF2 (University of Florida ICBR, HL1889), hnRNP C (Abcam, Ab10294), Flag (Cell Signaling Technologies, 2368S).