Pjet vector

The full length cDNA was obtained by performing 5′ and 3′ RACE-PCR and assembling the respective RACE fragments (Table 1) employing high fidelity Taq polymerase, Fermentas. The PCR program included an initial denaturation of 94°C for 3 min, followed by 35 cycles at 94°C (30 sec), annealing at 55°C (30 sec), extension at 72°C (3 min), and final extension at 72°C for 7 min. The resolved PCR fragment was visualized under ultraviolet light and gel electrophoresed on 1.2% agarose. The PCR amplicon corresponding to putative full length gene was gel purified by Qiagen gel purification kit according to manufacturer's instruction and cloned in pJET vector, Fermentas. The full length clone was confirmed through sequencing of the plasmid DNA.

This assay was adapted from published procedures [13 (link), 34 (link)]. Genomic DNA was extracted from samples using a PureGene protocol (Gentra) and quantified using Nanodrop instrumentation (ThermoFisher Scientific). 20 ng of genomic DNA was subjected to one round of normal high denaturation temperature PCR using Taq Polymerase (Denville) and primers for MYC (5’-ACGTTAGCTTCACCAACAGG and 3’TTCATCAAAAACATCATCATCCAG) or TP53 (5’GAGCTGGAGCTTAGGCTCCAGAAAGGACAA and 3’TTCCTAGCACTGCCCAACAACACCAGC). 383 bp and 376 bp PCR products were purified and quantified using qPCR with nested primer sets and SYBR Green detection (Roche 480 LightCycler; 5’ACGAGGAGGAGAACTTCTACCAGCA and 3’TTCATCTGCGACCCGGACGACGAGA for MYC and 5’TTCTCTTTTCCTATCCTGAGTAGTGGTAA and 3’TTATGCCTCAGATTCACTTTTATCACCTTT for TP53). Equivalent amounts of each PCR product were then used for 3D-PCR using the same nested PCR primer sets. The resulting 291 and 235 bp products were fractionated by agarose gel electrophoresis, purified using QIAEX II (Qiagen), cloned into a pJet vector (Fermentas), and subjected to sequencing (GENEWIZ). Alignments and mutation calls were done with Sequencher (Gene Codes Corporation).

Fibroblast colonies that formed in the presence of MMC were collected and expanded in 96 well plates. Cells were harvested, centrifuged for 5 minutes at 3000 rpm to remove media and dissolved in 100 μl Direct PCR Tail Lysis solution (VIAGEN) with Proteinase K (Sigma-Aldrich). Cell lysis took place overnight at 55° C followed by a 15 minutes 82° C heat inactivation step. 1 μl cell lysate was added to 24 μl PCR mix. PCR assays were performed as for the Surveyor assay, products were cloned into the pJET vector (ThermoScientific) and transformed into E. coli DH5α (New England Biolabs). Five to ten random colonies were picked from each bacterial plate representing Fancf alleles from a single cell clone. PJet inserts were amplified and Sanger sequencing was performed to assess gene editing-mediated DNA alterations in Fancf (Suppl. Table 5).

For 35S::At5g17960, full-length coding sequence of At5g17960 was PCR amplified using A15 FP and A15 RP and cloned into pJET vector (Thermo Scientific). Subsequently, the gene was released using XhoI/HindIII and cloned into pGREEN 35S vector digested with the same restriction enzymes. To construct amiR::At5g17960, amiRNA sequence (5’-GCGGGAAGCAAGTATCCACTT-3’) was designed using the amiRNA designer interface WMD [13 (link), 14 (link)]. The sequence was introduced into Arabidopsis miR319a precursor by overlapping PCR using primers (A15_I_mIR, A15_II_mIR, A15_III_mIR, A15_IV_mIR) and pRS300 plasmid as the template. The resulting fragment was cloned into pJET vector and subsequently digested with XhoI/SpeI and ligated into XhoI/SpeI digested linearized pGREEN 35S vector. All constructs were verified by sequencing. Primers used are listed in the S1 Table.

The target transcripts for miR156 cleavage were predicted using the psRNATarget web server by following the default parameter (http://plantgrn.noble.org/psRNATarget/). In addition, the mature sequence of L. japonicusmiR156 was used to conduct a manual BLAST search against the L. japonicus genome database and the NCBI EST database. This eliminated any false candidates that could form potential precursors for LjmiR156. After the redundant sequences were manually excluded, potential targets were chosen as candidates for cleavage-site validation using a modified 5′-RACE method (Song et al. 2010 (link)). This technique was performed with a FirstChoice RLM-RACE Kit (Life Technologies) according to the manufacturer’s instructions, but with a slight modification. Instead of removing 5′PO₄, the adaptor was ligated directly to the RNA molecules, which were then subjected to reverse-transcription. Afterward, nested PCRs were run with outer/inner adaptor- and outer/inner gene-specific primers (Supplementary Table 1). The products were gel-purified and cloned into the pJET vector (Thermo Scientific, Waltham, MA, USA). Eleven (11) clones for TC70253, 12 clones for AU089181, and 16 clones for TC57859 were sequenced to determine the cleavage sites of the two candidate genes.