Fixed testes were briefly permeabilized with 0.1% Triton-X in PBS for 5 min prior to applying phalloidin. For BODIPY (4,4-Difluoro-1,3,5,7,8-Pentamethyl-4-Bora-3a,4a-Diaza-s-Indacene) staining, samples were suspended in PBS containing 10 μg/ml DAPI (2879083-5 mg, PeproTech), 1:500 BODIPY 495/503 (Thermo Fisher Scientific D3922), and 1:1000 phalloidin iFluor647 (ab176759, Abcam) or 1:40 phalloidin TexasRed (T7471, Thermo Fisher Scientific). For staining with LipidTox Red, samples were suspended in PBS containing 10 μg/ml DAPI (2879083-5 mg, PeproTech), 1:200 LipidTox Red (H34476, Thermo Fisher Scientific), and 1:1000 phalloidin iFluor647 (ab176759, Abcam). For staining free sterols, samples were prepared as for BODIPY staining with 50 μg/ml filipin in place of BODIPY for 30 min. Samples were incubated on a rotating platform for 40 min at room temperature. After incubation, samples were washed twice with PBS, then resuspended in SlowFade Diamond mounting media (Thermo Fisher Scientific S36972) prior to mounting.
Ab176759
Manufactured by Abcam
Sourced in United Kingdom
Ab176759 is a primary antibody that binds specifically to the target antigen. It is suitable for use in various immunoassay applications.
Automatically generated - may contain errors
Lab products found in correlation
Lsm 900 confocal microscope, by Zeiss (6 mentions)
Ab131260, by Abcam (2 mentions)
Pkh26 red fluorescent cell linker mini kit, by Merck Group (2 mentions)
Ab150077, by Abcam (2 mentions)
Ab227198, by Abcam (2 mentions)
Hoechst 33342, by Thermo Fisher Scientific (2 mentions)
Ab271286, by Abcam (1 mentions)
Ab208670, by Abcam (1 mentions)
Ab219407, by Abcam (1 mentions)
Ab6124, by Abcam (1 mentions)
Ab16048, by Abcam (1 mentions)
Ab290, by Abcam (1 mentions)
Alexa fluor 488 goat anti rabbit, by Thermo Fisher Scientific (1 mentions)
Goat anti mouse cyanine3, by Thermo Fisher Scientific (1 mentions)
A10521, by Thermo Fisher Scientific (1 mentions)
A11008, by Thermo Fisher Scientific (1 mentions)
Prolong gold antifade mountant with dapi, by Thermo Fisher Scientific (1 mentions)
Ab34710, by Abcam (1 mentions)
Immunofix solution, by Bio-Optica (1 mentions)
4 6 diamidino 2 phenylindole (dapi), by Merck Group (1 mentions)
16 protocols using ab176759
1
Multicolor Fluorescence Staining Protocol
2
Endothelial Cell Stress Response
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cells were cultured on coverslips in 24-well plates. Upon reaching confluence, cells were challenged with hemoglobin, ferryl hemoglobin, and Peptides 1–5 for 7 h. Cells were fixed with 3.7% formaldehyde for 15 min. F-Actin was stained with iFluor 647 (ab176759, Abcam), Hoechst (33258) was used to stain nuclei. To show NF-kβ nuclear translocation, cells were challenged with Peptides 1–5, hemoglobin, and ferryl hemoglobin for 1.5 h. After treatment, the cells were fixed with 3.7% formaldehyde for 15 min. After fixation, the cells were blocked with 5% goat serum for 1 h at room temperature. Rabbit monoclonal antihuman NF-kβ (701079, Thermo Scientific, diluted 1:25) was used as a primary antibody to show NF-kβ nuclear translocalization in endothelial cells. AF488-labeled goat anti-rabbit secondary antibody (A11070, Thermo Scientific, diluted 1:500) was incubated with the cells for 1 h in the dark at room temperature. F-Actin was stained with iFluor 647 (ab176759, Abcam). Hoechst (33258) was used to stain nuclei.
3
Immunofluorescence Staining of Cytoskeletal Components
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cells were fixed in 4% paraformaldehyde, permeabilized with 0.1% Triton X‐100, blocked with 5% BSA and stained with the following: anti‐cit H3 (Abcam, ab219407, 1:1000), anti‐CD63 (Abcam, ab271286, 1:200), anti‐MPO (Abcam, ab208670, 1:100), anti‐NE (Abcam, ab131260, 1:250), and anti‐laminB1 (Abcam, ab16048; 1:1000), anti‐CD44 (Abcam, ab6124, 1:200), anti‐pERM (CST; 1:500), DAPI (Solarbio, D6470) and phalloidin (Abcam, ab176759). The cell membrane was stained with a PKH26 Red Fluorescent Cell Linker Mini Kit (Sigma, MINI26) according to the provided protocol before the cells were fixed. After staining, the cells were observed using a Zeiss LSM 900 confocal microscope.
Live cells were placed in a small incubator for visualization and fixed on the microscope stage. The incubator provided a constant temperature of 37°C and an atmosphere of 5% CO2.
Live cells were placed in a small incubator for visualization and fixed on the microscope stage. The incubator provided a constant temperature of 37°C and an atmosphere of 5% CO2.
4
Visualizing GFP-Labeled Proteins in Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cells were grown in monolayer on coverslips for 48 h +/− 10 μM Trimethoprim (TMP). Medium was removed and cells were fixed and permeablised with 4% formaldehyde and 0.1% Triton for 20 min at room temperature. Non-specific binding was blocked using 1% BSA before antibody staining: rabbit anti-GFP (ab290, Abcam), Phalloidin-TRITC (P1951, SIGMA) or Phalloidin-iFluor 647 (ab176759, Abcam), Goat anti-Rabbit Alexa Fluor 488 (A11008, Thermo) and Goat anti-Mouse Cyanine3 (A10521, Thermo). Coverslips were mounted with ProLong™ Gold Antifade Mountant with DAPI (P36940, Thermo).
5
Immunofluorescent Imaging of Collagen Deposition
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
After 3 days in culture the morphology of seeded cells was visually checked by immunofluorescent imaging (IF). For IF staining, cells were fixed at room temperature by Immunofix solution (Bio Optica, Milan, Italy) for 15 min; then, they were washed 3 times with PBS and stained for collagen deposition using an anti-collagen I antibody (ab34710, from AbCam, Cambridge, UK) overnight at 4°C. The day after, collagen was unmasked by an appropriate secondary antibody and cells were co-stained with phalloidin (ab176759, AbCam, Cambridge, UK) and 4′,6-diamidino-2-phenylindole (DAPI, Sigma-Aldrich, Milan, Italy) to visualize cytoskeleton f-actin filaments and nuclei, respectively.
6
Fluorescence Microscopy of BMDM Infection
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For fluorescence microscopy experiments, BMDMs (0.5 × 106) were seeded in a 4-chamber μ-slide (80426, Ibidi). Chambers were infected as described above. Wells were aspirated and fixed in 4% paraformaldehyde (PFA), washed with PBS, permeabilized with 0.1% Triton X-100, and stained with phalloidin-iFluor647 (ab176759, Abcam), and DAPI (4′,6-diamidino-2-phenylindole). For confocal images, a Nikon C2 microscope was used as previously described (59 (link)). Quantitative cell death measurements by SYTOX Green or PI uptake counts were collected hourly on an IncuCyte S3 system (Essen BioScience). Within each replicate well (on a 96-well plate), nine images were collected, and cell death was quantified using the Basic Analyzer software of the IncuCyte S3 and exported as “object count per well,” which extrapolates the “object count” from the average count across images to the total well area. At least four replicate wells were included for each experiment, and these replicate wells were used to determine statistical significance between treatment conditions.
7
Immunofluorescence Staining Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For immunofluorescence, cells were fixed in 4% paraformaldehyde, permeabilized with 0.2% triton X-100/phosphate-buffered saline (PBS), and blocked in 5% BSA. Cells were incubated with primary antibodies overnight at 4°C in primary antibody dilution buffer (P0256, Beyotime) and then with secondary antibodies conjugated with 594 (ab150077, Abcam) for 1 h at room temperature. For F-actin, cells were stained with Phalloidin-iFluor 647 reagent (ab176759, Abcam) for 1.5 h. Images were analyzed under confocal microscopy (Nikon A1, Tokyo, Japan).
8
Integrin β1 signaling modulation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Antibodies against the focal adhesion protein Zyxin (ab50391, 1:200), Vinculin (ab129002, 1:200), Phalloidin (ab176759, 1:1000), and the serine-threonine kinase GSK3 (ab93926, 1:4000) were obtained from Abcam. ITGβ1 antibody was obtained from Proteintech (12594-1-AP, 1:100), while anti-γ-Tubulin antibody was obtained from Sigma (T6557, 1:3000). Secondary antibodies for immunostaining (1:500) were from Jackson ImmunoResearch Laboratories, Inc (715166150, 711545152). Secondary antibodies coupled to Infrared Dyes (IRDye 680 (926–68072) and IRDye 800 (926–32213) at 1:3000 (LI-COR) were used for western blots and analyzed with the LI-COR Odyssey system.
Primers for cloning human DN-ITGβ1 into pCS2 c-terFlag were Inte-Forward: GGCGGATCCACCATGAATTTACAACCAATTTTCTG, Inte-Reverse: GGCATCGAT TATCATTAAAAGCTTCCATATCAG. Primers for cloning human ITGβ1-WT into pCS2 Inte-WT- Reverse: GGCATCGATTTTTCCCTCATACTTCGGA. Pools of 3 target-specific ITGβ1 (sc-35674) and control siRNAs (sc-37007) were obtained from Santa Cruz Biotechnology. Xenopus laevis ITGβ1 antisense MO, sequence 5’GTGAATACTGGATAACGGGCCATCT3’, was designed with the help of GeneTools.
Primers for cloning human DN-ITGβ1 into pCS2 c-terFlag were Inte-Forward: GGCGGATCCACCATGAATTTACAACCAATTTTCTG, Inte-Reverse: GGCATCGAT TATCATTAAAAGCTTCCATATCAG. Primers for cloning human ITGβ1-WT into pCS2 Inte-WT- Reverse: GGCATCGATTTTTCCCTCATACTTCGGA. Pools of 3 target-specific ITGβ1 (sc-35674) and control siRNAs (sc-37007) were obtained from Santa Cruz Biotechnology. Xenopus laevis ITGβ1 antisense MO, sequence 5’GTGAATACTGGATAACGGGCCATCT3’, was designed with the help of GeneTools.
9
Immunofluorescence Microscopy of Transfected Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Two- or three-days post-transfection, cells were fixed with 4% paraformaldehyde for 15 min for MDA-MB-231 cells and 10 min for HEK-293T at RT. Cell permeabilization was carried out using 0.1% Triton X-100 in PBS for 10 min at RT. Cells were then blocked with 5% BSA, 0.15% Tween 20 in PBS for 1 h at RT. Next, cells were incubated with primary antibody O/N at 4°C. Cells were then incubated with Alexa Fluor-conjugated secondary antibody for 1 h at RT. Actin was labeled using cytoPainter Phalloidin iFluor diluted 1:1000 with secondary antibody according to the manufacturer's protocol (Abcam, Ab176759). Antibody references and dilutions are provided in Table S4 . The coverslips were finally incubated with Hoechst (Invitrogen, 33342) for 30 min and then mounted with VECTASHIELD mounting media (Vector Laboratories). Images were acquired with a Zeiss LSM 710 BiG confocal microscope using an 63× PL APO oil DIC On 1.4 objective for all experiments. Images were taken in z-stacks with a voxel size of 300 nm. Images shown are z-stacks or maximum intensity projections of z-stacks.
10
Multiparametric Immunofluorescence Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cells were fixed in 4% paraformaldehyde, permeabilized with 0.1% Triton X-100, blocked with 5% bovine serum albumin and stained with the following: anti-NF-κB (Abcam, ab16502, 1:2000), anti-α-SMA (Abcam, ab7817; 1:2000), anti-TLR9 (Abcam, ab134268; 1:2000) and anti-collagen III (Abcam, ab131260; 1:2000). 4′,6-diamidino-2-phenylindole (DAPI, Solarbio D6470) and phalloidin (Abcam, ab176759) were used to staining nucleus and cytoskeleton, respectively. The cell membrane was stained with a PKH26 Red Fluorescent Cell Linker Mini Kit (Sigma, MINI26) according to the provided protocol before the cells were fixed. After staining, the cells were observed using a Zeiss LSM 900 confocal microscope.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!