Alkaline phosphatase conjugated anti digoxigenin antibody

EnCL1/EnCL3 gene-specific primers (Additional file 3) and first-strand cDNA of adult E. nipponicum were used for the PCR. The amplified products were ligated into pGEM®-T Easy vector (Promega, Madison, Wisconsin) and verified by DNA sequencing. The constructs were linearised and used as a template for RNA probes. Both sense and anti-sense RNA probes were synthesised in vitro (Dig RNA Labelling Kit (SP6/T7); Roche, Basel, Switzerland). In situ hybridisation was performed using a modified protocol [44 (link)]. Briefly, the sections of adult worms on slides were incubated for 19 h at 41 °C (EnCL1) and at 37 °C (EnCL3) with specific RNA probes diluted 1:100 in a hybridisation mixture (5× SSC, 1× PBS, 50% deionised formamide, 1% Tween-20, 10% dextran sulphate Mw 500×, 1 mg/ml Torula yeast RNA). Detection was achieved with alkaline phosphatase-conjugated anti-digoxigenin antibodies (1:500, Roche) and Fast Red TR substrate (Sigma-Aldrich). Negative controls were incubated under the same conditions but with an anti-sense probe or without a probe. Specific strand RT-PCR was used for the detection of natural anti-sense transcripts occurring in the monogenean cells [45 (link)].

The genomic abundance of TRIM elements was determined by dot-blot analysis. Serial dilutions of genomic DNAs and positive controls (TDR domains derived from TRIM elements of all examined species) were spotted onto positively charged nylon membranes (Roche). As negative controls, we used serial dilutions of unrelated DNA sequence holding just short fragments of similarity to TRIM elements, plasmid DNA without any insert and genomic DNA of the unrelated insect species Tenebrio molitor. The amounts of spotted DNA are given in Supplementary Table S1. Hybridization was performed with a digoxigenin-labeled probe derived from the TRIM elements of all examined species. It was conducted at 65 °C in 20 mM sodium phosphate buffer (pH 7.2), 20% SDS, 1 mM EDTA and 0.5% blocking reagent. Post-hybridization washes were performed at 62 °C in 0.1 × SSC, 1% SDS, allowing sequences with >75% of similarity to remain paired. Signals were detected with alkaline phosphatase conjugated anti-digoxigenin antibodies (Roche) using CDP-Star (Roche) as a substrate. Signals were quantified using ImageJ (https://imagej.nih.gov/ij/) program.

Whole-mount in situ hybridization (WISH) was performed as previously described [45] (link). Embryos were fixed in 4% phosphate-buffered paraformaldehyde (PFA/PBS, Merck). The embryos were rehydrated and treated with proteinase K for RNA probe penetration. The 1.5-kb sequence for synthesizing adar2 riboprobe, comprising of the RNA binding domains, catalytic domain and 3′-UTR, was amplified by primers AACATGCAGCTGGACCAAACAC and AACAGAGACAAAAAAGGTGTGTGGAG, and cloned to pBlueScriptII. Antisense riboprobe was labeled with digoxigenin (Roche), recognized by alkaline phosphatase-conjugated anti-digoxigenin antibodies (Roche) and stained with NBT/BCIP (Roche). Zeiss AxioImager.M1 microscope and Zeiss AxioCam HRc camera were used to visualize and captured the images. Multiple images were combined with Adobe Photoshop CS2 software.

At 48 h following the treatment with siRNA, total RNAs were extracted from the cells using TRI REAGENT (Molecular Research Center, Inc.). Purified total RNAs (4 μg) were denatured and separated by 0.8% formaldehyde-agarose gel electrophoresis, and the gel was stained with GelRed Nucleic Acid Gel Stain (Biotium, Inc.). The fractionated RNAs were transferred and cross-linked to an Amersham Hybond-N+ membrane (Cytiva), which was used for prehybridization and hybridization with the DIG-labeled 5.8S+ probe (Sirri et al, 2016 (link)) using DIG Easy Hyb buffer (Roche) at 50°C. After washing, the membrane was incubated with the DIG Wash and Block Buffer Set (Roche) and alkaline phosphatase–conjugated anti-digoxigenin antibodies (Roche). Detection of alkaline phosphatase–labeled 47S pre-rRNA was performed using the chemiluminescent substrate CDP-Star (Roche).

Digoxigenin-labelled riboprobes were synthesised with DIG RNA Labelling Mix (ROCHE), Thermo T7 RNA Polymerase (ToYoBo), and gene templates cloned using T7 promoter-containing PCR primer sets (Supplementary Table) and mouse embryonic brain cDNA pools. Fresh-frozen sections of E14.5 mouse embryos were washed twice with PBS-DEPC and fixed with 4% paraformaldehyde for 12 h at 4 °C. The sections were then serially treated with 6% H₂O₂ for 20 min, 10 μg/ml proteinase K solution for 5 min, and post-fix solution (4% paraformaldehyde, 0.2% glutaraldehyde, and 0.1% Tween in PBS-DEPC) for 20 min at room temperature. After incubation with prehybridisation mix (50% formaldehyde, 5 × SSC pH 5, 150 μg/ml yeast RNA, 150 μg/ml heparin, 1% SDS, and 0.1% Tween) for 30 min at 65 °C, hybridisation was performed overnight with the same solution containing a digoxigenin-labelled riboprobe. Sections were then washed several times with SSC of increasing stringency and subsequently incubated with alkaline phosphatase-conjugated anti-digoxigenin antibodies (Roche). Nitro blue tetrazolium and 5-bromo-4-chloro-3-indolyl-phosphate (Roche) were used for the colorimetric detection of alkaline phosphatase activity, followed by nuclear staining with 4′,6-diamidino-2-phenylindole (DAPI; Invitrogen). Both bright-field and nuclear staining images were separately taken using a Keyence BZ-X700 All-in-One microscope.

Genomic DNAs were digested with HaeIII (Fermentas), HpaII (Fermentas), MspI (Promega), PvuII (New England Biolabs) and TaqI (Roche). Restriction products were resolved by gel electrophoresis, transferred to positively charged nylon membranes (Roche), and hybridized overnight with the DIG-labelled SSUsat probe. To test homology in low, moderate and high stringency conditions, different experimental temperatures (60, 65 and 68 °C) were used. Signals were detected with alkaline phosphatase conjugated anti-digoxigenin antibodies (Roche) using CDP-Star (Roche) as substrate.
The proportions of the satellite present in the genomes of S. subtruncata, S. solida, M. stultorum and D. trunculus were estimated by dot blotting. Serial dilutions of genomic DNAs (10–250 ng) and cloned SSUsat (0.3–10 ng) were dot-blotted onto positively charged nylon membranes (Roche) and hybridized with SSUsat probes. Hybridisation signals were quantified using ImageJ (http://imagej.nih.gov/ij/).