Pgl4.10 vector

For luciferase assays, the mouse locus chr13:112986313–112987887 (Ccno promoter) and chr13:112986313–112987887 Δ112987750–112987392 (Delta Ccno promoter), containing or missing (Delta) putative AhR responsive elements and encompassing the Ccno gene transcription start site, were cloned into the EcoRV/HindIII restriction sites of the pGL4.10 vector (Promega). pRL-CMV (Promega) was used as an internal control for transfection efficiency.

To generate the Sebox firefly luciferase reporter, the full-length sequence of the Sebox 3′UTR (NM_008759.2: 611-1285), encompassing the MRE of miR-125a-5p, miR-125b-5p and miR-351-5p, was amplified using the forward primer GCTAGCTTTAGGTGTAGAGCTTTTAAGT and the reverse primer AAGCTTTTAAAGCAAAGAGTTTTGTTTT. To generate the Lin28a firefly luciferase reporter, the sequence of the Lin28a 3′UTR (NM_145833.1: 1193-1846)-containing MRE was amplified using the forward primer GCTAGCGATGACAGGCAAAGAGGGTG and the reverse primer AAGCTTAGGCTTCCACTAATCTGGCA. The Sebox 3′UTR (675 bp) and Lin28a 3′UTR (654 bp) PCR products were digested with NheI and HindIII. Then, the digested PCR products were cloned into a NheI- and HindIII-opened pGL4.10 vector (Promega). The sequences of the constructs were confirmed by DNA sequencing.

The DPYD promoter region, consisting of the 1154 bp of genomic DNA directly upstream of the DPYD TSS, was amplified by PCR, digested with EcoRV and HindIII (New England Biolabs), and cloned into compatible sites on the pGL4.10 vector (Promega). The 1392-bp region comprising the E9 region was PCR amplified from genomic DNA and cloned upstream of the DPYD promoter using KpnI and SacI sites (New England Biolabs). A vector containing the A allele of rs4294451 within E9 was confirmed by Sanger sequencing. The vector containing the rs4294451 T allele was generated by site-directed mutagenesis and confirmed by sequencing. All primers used in vector construction are listed in Supplementary Table S1. For reporter assays, 10⁵ HEK293T cells were seeded into 24-well plates and co-transfected with pGL4.10-based plasmids and pRL-SV40 Renilla luciferase plasmid (Promega). After 48 hours, luciferase activity was measured using the Dual-Glo Luciferase Assay (Promega) following manufacturer’s recommendations on a Synergy HTX Multimode Plate Reader (Agilent Technologies, Santa Clara, CA).

pGL4.10 vector (Promega, Madison WI, USA) was used for construction of luciferase reporter plasmids. A reporter plasmid (designated p21up/GL4) containing a human p21 promoter region encompassing from −2266 to −1875 was described previously [14 (link)]. The +1 position represents the transcription start site of the downstream promoter. In this study, we constructed two new luciferase reporter plasmids, p21down/GL4 and p21core/GL4, that contain a downstream promoter region from −168 to +66 and a short DNA stretch from −5 to +66 of the p21 downstream promoter, respectively. These constructs were generated by a PCR-based strategy using a reporter plasmid encompassing from −2677 to +66, which has been named p21luc1 as previously described [14 (link)]. Primer sets to amplify DNA fragments from −168 to +66 and from −5 to +66 sequences were as follows: −168 to +66 forward, 5′-CTCGAGGGCCTGCTGGAACTCGGCCAG; −5 to +66 forward, 5′-CTCGAGGCGCCAGCTGAGGTGTGAGCA; and common reverse, 5′-AGATCTCGGCGAATCCGCGCCCAGCT.

The YAP1 promoter and +82 kb enhancer sequence were PCR amplified and gel purified with primers ordered from Eurofins Genomics (Eurofins Genomics, Ebersberg, Germany) (Table S2-A). pGL4.10 vector (Promega, Madison, WI, USA) was digested with HindIII and gel purified. In-Fusion cloning (Clontech, Fremont, CA, USA) was carried out according to the manufacturer’s protocol, using gel-purified linearized pGL4.10 vectors and promoter insert in a 1:2 molar ratio. 2.5µl cloning reaction was used for transformation of One Shot TOP10 chemically competent E. coli (Thermo Fisher Scientific, Waltham, MA, USA). Colonies were isolated and sequenced (Beckman Coulter Genomics, Brea, CA, USA). For the construction of the pGL4.10-YAP1 promoter+enhancer plasmid, the pGL4.10-YAP1 promoter plasmid was digested with SalI restriction endonuclease and gel purified, and In-Fusion cloned with enhancer insert using the same procedure.

Genomic fragments of β-peaks were amplified by PCR and subcloned into the pGL4.10 vector (Promega) or a derivative vector pβ-actin-luc carrying a heterologous basal promoter. Embryos were injected with 40 pg reporter plasmid DNA together with 40 pg pRL-CMV (Promega) at the two- to four-cell stage, collected at the early gastrula stage, and assayed for luciferase activity. For cloning into luciferase reporter constructs, see the supplementary Materials and Methods.