T 5224

Recombinant SARS-CoV-2 E Protein was purchased from Novoprotein (Shanghai, China), and the target gene was expressed with a β-barrel protein platform and 6 × His tag at the N-terminus,^{60 (link)} and dissolved in the solution of 20 mM Tris-HCl and 200 mM NaCl. SARS-CoV-2 Spike S1 and S2 recombinant protein were purchased from Sino Biological (Beijing, China). SARS-CoV E protein was purchased from Glpbio (USA); rolipram from Sigma Aldrich (USA); C29, Resatorvid, SP600125, T-5224 and EMD638683 from MedChemExpress (MCE, USA).

Human ovarian cancer cell lines, OVCA420 and ES‐2, used in the study were commercially purchased from American Type Culture Collection. The protocol and condition of cell culture were described previously.⁵⁹ siRNA transfection was conducted using Hieff TransTM Liposomal transfection reagent (Yeasen, Shanghai, China) as described.⁵⁹ The JUN/AP‐1 inhibitor T‐5224 was purchased from MedChemExpress (Shanghai, China). The siRNA sequences used were as follows, siANPEP‐1: GTAAAGCGTGGAATCGTTATT, siANPEP‐2: GGAACCTGGTGACCATAGATT, siCASP14‐1: CGGCAGCTGAGATTCGAAATT, siCASP14‐2: GACATATCTTGGAACTTCTTT, siCLEC2B‐1: GAATTTTCTTAGGCGGTATTT, siCLEC2B‐2: ATACAACTGTTCCACTCAATT, siCADM3‐1: AGATCCACCTCTCAACGCATT, siCADM3‐2: CACTGGTTATAAATCTTCATT, siNRBP2‐1: AGAGATTTCTATGCCCTCATT, siNRBP2‐2: CAGTGCAACCTGGAGAGAATT, siSPC25: GATCGACTTGGACTAGAAATT, siESCO2‐1: CAAAATCGAGTGATCTATATT, siESCO2‐2: GTATCAACCAAAGTATAGATT, siGTSE1‐1: GGAATTAAATAATCCGGTTTT, and siGTSE1‐2: CGGCCTCTGTCAAACATCATT.

The western blot analyses were performed as previously described [21 (link)]. The following antibodies were used for the western blot analysis: anti-c-Jun (sc-166540), anti-phospho-c-Jun (sc-822), anti-intracellular adhesion molecule-1 (anti-ICAM-1) (sc-8439), and anti-β-actin (all from Santa Cruz Biotechnology, Santa Cruz, CA, USA). β-Actin was used as the loading control. Phorbol 12-myristate 13-acetate (PMA; Glentham Life Science, Corsham, UK) and T-5224 (MedChemExpress, NJ 08852, USA) were used to enhance and inhibit AP-1 activation, respectively. The protein bands in the western blot films were quantified with the ImageJ software (NIH). All experiments were performed in triplicate and repeated at least three times.

The protocol for ethanol extraction of D. kaki was well described in our previous study^{13 (link)}. EEDK was dissolved in Dimethyl sulfoxide (DMSO; Biosesang, Seongnam, Republic of Korea) prior to cell treatments. DMSO was used as a negative control, and the final DMSO concentration did not exceed 0.5% (v/v). Fluo-3 was purchased from Invitrogen (Carlsbad, CA). Epidermal growth factor (EGF) and cobalt chloride (CoCl₂) were purchased from Sigma (St. Louis, MO). T-5224 and anisomycin are commercially available from MedChemExpress (Monmouth Junction, NJ). Pepstatin A was obtained from ENZO Life Science (Farmingdale, NY).

Further confirming the effect of DHA on c-FOS activity, the mice of DHA plus T5224 group were given T5224 (30 mg kg⁻¹) and DHA (200 μL, 0.1 mg/mL) orally for 8 consecutive days. Mice in the control group received DHA alone, CMC, and an equal volume of solvent control at the dosage recommended by the manufacturer. T_reg cells were isolated from the mice and subsequently lysed and extracted by using total protein extraction kit. The precipitated protein from T_reg was dissolved in sample buffer and separated with 10% SDS-PAGE and subsequently was transferred to PVDF membranes. After transferring to PVDF membranes, proteins were detected using MCM2- or CDK2- or β-actin-specific antibodies. T5224 was purchased from MedChemExpress Company.

SCFAs were obtained from Sigma-Aldrich (St. Louis, MO, USA). Erastin, ferrostatin-1, FIN56, necrostatin-1, oxaliplatin, RSL3,pertussis toxin, Entinostat, Ricolinostat, Nicotinamide, SIS17, T5224 and TMP269 were purchased from MedChemExpress (Shanghai, China). DCFH-DA, Hoechst33342, N-acetyl-l-cysteine, propidium iodide, trichostatin A, and Z-vad-FMK were obtained from Beyotime (Shanghai, China). Other cytokines/chemicals included B27 (Invitrogen, Carlsbad, CA, USA), recombinant human EGF and FGF (PeproTech, Rocky Hill, NJ, USA), Cystine (Solarbio, Beijing, China), C11-BODIPY 581/591 dye (Abclonal, Wuhan, China).