All experiments were conducted under biosafety level (BSL)-2 conditions. The swab-containing tubes were swirled, and the supernatants were collected after centrifugation. AIV RNAs were extracted using the MagMAX™ Pathogen RNA/DNA Kit (Applied Biosystems, Foster City, CA, USA) with the Magmax-96 Express instrument (Applied Biosystems). After extraction, the samples were screened for the presence of AIVs by real-time reverse transcription PCR (qRT-PCR) with primers and probes (WHO, 2009) specific to the matrix gene using a 7500 real-time PCR instrument (Applied Biosystems). The positive samples were transcribed into cDNA using the Uni12 primer (5ʹ-AGC AAA AGC AGG-3ʹ) and PrimeScript™ II 1st Strand cDNA synthesis kit (Takara, Japan). AIV subtypes were determined using primers specific to HA and NA genes [19 (link),22 (link)], and the eight segments of the H10–H12 AIV isolates were amplified using universal primers [23 (link)]. The PCR reactions consisted of 1 μL of cDNA, 1 μL each of forward and reverse primers, 12.5 μL of Taq HS Perfect Mix (Takara, Shiga, Japan) and 10.5 μL of RNAse-free water, with a final volume of 25 μL. All PCR products were sequenced by Sangon Biotech Co, Ltd (Shanghai, China) using a BigDye termination kit on an ABI 3730 sequence analyzer (Applied Biosystems, Foster City, CA, USA).
Taq hs perfect mix
Manufactured by Takara Bio
Sourced in China, Japan
Taq HS Perfect Mix is a high-sensitivity polymerase enzyme designed for reliable and efficient DNA amplification. It is optimized for consistent performance across a wide range of applications.
Automatically generated - may contain errors
Lab products found in correlation
Sybr green, by BioTeke (11 mentions)
M mlv reverse transcriptase, by Takara Bio (6 mentions)
Exicycler 96, by Bioneer (2 mentions)
Total rna rapid extraction kit, by BioTeke (2 mentions)
High purity total rna rapid extraction kit, by BioTeke (2 mentions)
Rnapure high purity total rna rapid extraction kit, by BioTeke (2 mentions)
Bigdye termination kit, by Thermo Fisher Scientific (2 mentions)
Rneasy mini kit, by Qiagen (2 mentions)
Exicycler 96 real time quantitative thermal block, by Bioneer (2 mentions)
Magmax pathogen rna dna kit, by Thermo Fisher Scientific (1 mentions)
Abi 3730 sequence analyzer, by Thermo Fisher Scientific (1 mentions)
7500 real time pcr instrument, by Thermo Fisher Scientific (1 mentions)
Primescript 2 1st strand cdna synthesis kit, by Takara Bio (1 mentions)
M mlv, by Takara Bio (1 mentions)
Primpscript rt reagent kit, by Takara Bio (1 mentions)
Icycler, by Takara Bio (1 mentions)
Rnaiso plus, by Takara Bio (1 mentions)
Rnapure total rna isolation kit, by BioTeke (1 mentions)
Nana drop 2000, by Thermo Fisher Scientific (1 mentions)
Nano 2000 ultraviolet spectrophotometer, by Thermo Fisher Scientific (1 mentions)
20 protocols using taq hs perfect mix
1
Avian Influenza Virus Subtyping Protocol
2
Real-Time PCR Analysis of δ-Catenin Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from RCC cells using total RNA rapid extraction kit (BioTeke, RP1201) according to the manufacturer's protocol. The obtained RNA was reverse transcribed into cDNA by M‐MLV (Takara, 2641A). The cDNA was used to perform real‐time PCR with Taq HS Perfect Mix (Takara, R300A) and SYBR Green (BioTeke, EP1602). The data were determined by Exicycler™ 96 (Bioneer, Daejeon, Korea), calculated by 2−∆∆Ct parameters. Sequences of real‐time PCR primers were as follows: δ‐Catenin: forward: 5ʹ‐TCTGAGAAACCTGGTGTATGG‐3ʹ, reverse: 5ʹ‐CAGTCGTCTTGCGGAGTAA‐3ʹ, β‐actin: forward: 5ʹ‐CCACTGCCGCATCCTCTT‐3ʹ, reverse: 5ʹ‐GGTCTTTACGGATGTCAACG‐3ʹ.
3
Quantifying miR-377-3p and NRP2 Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from aortas and human VSMCs using RNApure total RNA fast isolation kits (BioTeke, Beijing, China) according to the manufacturer’s protocols. The concentration of total RNA was quantified by a spectrophotometer (Thermo Fisher Scientific). Reverse transcription was performed to synthesize cDNA using reverse transcriptase M-MLV (Takara, Otsu, Japan) and oligo (dT)15 and random primers or specific miRNA RT primers. The quantitative real-time polymerase chain reaction (qRT-PCR) of miR-377-3p and NRP2 was performed with SYBR Green (BioTeke) and Taq HS Perfect Mix (Takara). U19 and β-actin were used to normalize miR-377-3p and NRP2 expression, respectively. The relative levels were presented as 2−ΔΔCt. The primer sequences used in the present study were listed in Table 1 .
4
CHRDL2 Gene Expression Analysis in Colorectal Cancer
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Five pairs of colorectal cancer tissues were used for CHRDL2 gene expression analysis. Total RNA was isolated from tissues using RNAiso Plus (Takara, Dalian, China), and First-strand cDNAs were prepared using the Primpscript RT reagent kit (Takara, Dalian, China). RT-PCR was performed using a Bio-Rad icycler and TaKaRa Taq HS Perfect Mix (Takara, Dalian, China). The CHRDL2 gene cDNA cloning primers used were: Forward, 5’-TCACCGAAGCTTATGGTTCCCGAGGTGAGG-3’; Reverse, 5’-TCACCGGGTACCGGTCTTTGTTATGTCTTGGTC-3’. PCR conditions were: 95°C for 5 min, followed by 30 two-step cycles (95°C for 40 s, 60°C for 40 s and 72°C for 60 s). RT-PCR products were analyzed on agarose gels and verified by DNA sequencing.
5
Quantification of Gene Expression in Ovary and Skeletal Muscle
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from ovary or skeletal muscle tissues using a RNApure total RNA isolation kit (Bio Teke, Beijing, China). The concentration of RNA was detected on an ultraviolet spectrophotometer (Nana Drop 2000, Thermo Scientific, USA). Subsequently, cDNA was synthesized using M-MLV Reverse Transcriptase (Takara, Japan). Real time PCR was carried out using Taq HS Perfect Mix (Takara) and SYBR Green (Bio Teke) on an Exicycler™ 96 Real-Time Quantitative Thermal Block (BIONEER, Korea). The primer sequences are presented in Table 1 . The mRNA expression level was calculated by 2-△△CT method.
Oligonucleotide primer sets for real-time PCR
| Name | Sequence (5′¬3′) | Length |
|---|---|---|
| CYP17 F | TGGAGGTGATAAAGGGTT | 18 |
| CYP17 R | CGTCAGGCTGGAGATAGA | 18 |
| CYP19 F | GCCTGTCGTGGACTTGGT | 18 |
| CYP19 R | TAAATTCATTGGGCTTGG | 18 |
| PPARγ F | TACCACGGTTGATTTCTC | 18 |
| PPARγ R | AATAATAAGGCGGGGACG | 18 |
| PGC-1α F | GAACAAGACTATTGAGCGAACC | 22 |
| PGC-1α R | GAGTGGCTGCCTTGGGTA | 18 |
| β-actin F | CCACTGCCGCATCCTCTT | 18 |
| β-actin R | GGTCTTTACGGATGTCAACG | 20 |
6
Gene Expression Analysis of Metabolic Regulators
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The total RNA was extracted with RNApure extraction kit (BioTeke, Beijing, China), and the concentration was measured with NANO 2000 ultraviolet spectrophotometer (Thermo Scientific, Waltham, MA, USA). The RNA was reversely transcribed into cDNA with M-MLV reverse transcription (TAKARA, Japan) with Oligo(dT) and random primer. The instruments and reagents used in reverse transcription were RNase-free. The cDNA was used for real-time PCR with Taq HS Perfect Mix (TAKARA) and SYBR Green (BioTeke) to detect the mRNA levels of ANGPTL8, tumor necrosis factor-α (TNF-α), interleukin (IL)-1β and IL-6. β-actin served as the internal control. The PCR procedure was set as follow: 94°C for 5 min 20 s, 60°C for 30 s, 72°C for 40 s, and 40 cycles of 72°C for 5 min 30 s, 40°C for 4 min 30 s, melting 60-90°C every 1°C for 1 s, and incubated at 25°C for several minutes. The PCR ran in Exicycler TM96 quantitative thermal block. The data were calculated using 2-ΔΔCt method. The primers were purchased from Genscript (Nanjing, Jiangsu, China), and the information was shown in Table 1
7
Quantification of miR-183-5p and PTEN mRNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from the ischemic penumbra or N2A cells using the RNApure kit (BioTeke Corporation) according to the manufacturer's instructions. To determine miR-183-5p or PTEN mRNA expression, reverse transcription was performed using M-MLV Reverse Transcriptase (2641A, Takara Biotechnology Co., Ltd.) according to the manufacturer's directions. Real-time PCR was subsequently conducted using Taq™ HS Perfect Mix (Takara Biotechnology Co., Ltd.) and SYBR® Green (BioTeke Corporation). The forward and reverse primers of miR-183-5p, U19, PTEN and β-actin used for real-time PCR were as follows: miR-183-5p, 5′-GCGGCTATGGCACTGGTAGAA-3′ and 5′-GTGCAGGGTCCGAGGTATTC-3′; U19, 5′-TGTGGAGTTGGTCCTGGTCT-3′ and 5′-GTGCAGGGTCCGAGGTATTC-3′; PTEN, 5′-GACCATAACCCACCACAGC-3′ and 5′-CATTACACCAGTCCGTCCCT-3′; β-actin, 5′-AATCGTGCGTGACATCAA-3′ and 5′-AGAAGGAAGGCTGGAAAA-3′. Relative miR-183-5p was calculated using the 2−ΔΔCq method (24 (link)) and normalized to U19. Relative PTEN expression was calculated using the same method and normalized to β-actin.
8
Quantification of miR-188-5p Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Real-time PCR was performed to measure relative expression levels of miR-188-5p. High purity total RNA rapid extraction kit (BioTeke, Beijing, China) was adopted to extract total RNA of samples. Extracted RNAs were reversely transcribed into cDNAs using M-MLV reverse transcriptase (Takara, Beijing, China) with RNase inhibitor (Takara) by Stem loop method. Followed real-time PCR reaction was performed with the help of Taq HS Perfect Mix (Takara) and SYBR Green (BioTeke). The U19 and β-actin were adopted as an internal reference. The primers were synthesized by GenScript (Nanjing, China) and sequences of them were listed as follow: miR-188-5p (forward): 5′-CGATATTCATCCCTTGCATGGT-3′; (reverse): 5′-TGCAGGGTCCGAGGTATT-3′; U19 (forward): 5′-TGGAGTTGATCCTAGTCTGG-3′; (reverse): 5′-GTGCAGGGTCCGAGGTAT-3′. MALAT1 (forward): 5′-ATACCTAACCAGGCATAACA-3′; (reverse): 5′-AGTAGACCAACTAAGCGAAT-3′; β-actin (forward): 5′-GGCACCCAGCACAATGAA-3′; (reverse): 5′-TAGAAGCATTTGCGGTGG-3′. Finally, the results were analyzed using 2−ΔΔCT methods.
9
Quantifying Gene Expression in Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from bone tissues or transfected EA.hy926 cells using an RNApure high-purity total RNA rapid extraction kit (BioTeke, China) following the manufacturer’s protocol. Afterward, total RNA was reverse-transcribed into cDNA using M-MLV reverse transcriptase and RNase inhibitor (Takara, Japan). qRT-PCR was conducted using Taq HS Perfect Mix (Takara, Japan) and SYBR Green (BioTeke, China) in an Exicycler 96 PCR system (BIONEER, Korea). Relative quantification of gene expression was determined using the 2−ΔΔCt method. β-actin was employed as a housekeeping gene for internal normalization. Primer sequences (5′–3′) are as follows: Rat Sox11, forward-AGGATGCCGACGACCTCATG, reverse-GAAGTTCGCCTCCAGCCAGT; Human SOX11, forward-ACGGTCAAGTGCGTGTTTCTG, reverse-TGCTGGTGCGGTGGTTCCTC; Human CD31 (gene name PECAM1), forward-AAGATAGCCTCAAAGTCG, reverse-CTGGGCATCATAAGAAAT.
10
Quantification of PAI-1, uPA, and tPA mRNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The relative mRNA expression of PAI-1, uPA, and tPA was analyzed by real-time PCR. Total RNA was extracted and quantified (UV spectrophotometer). RNA samples were reverse-transcribed into cDNA templates on a PCR system (BIONEER, Daejeon, Korea). Quantitative real-time PCR was conducted using the template, primers, Taq HS Perfect Mix (TaKaRa, Tokyo, Japan), and SYBR Green (BioTeke, Beijing, China) on the PCR system. The sequences of primers were shown as follows: PAI-1F, 5′-ATGCCATCTTTGTCCAGC-3′; PAI-1R, 5′-TCTGAGAAGTCCACCTGTTT-3′; uPA F, 5′-TAGACCAACAAGGCTTCC-3′; uPA R, 5′-GAGACTCCCACCACATTTA-3′; tPA F, 5′-AGTGCCCTGATGGATTTG-3′; tPA R, 5′-GTCTCGGTCTGGGTTTCT-3′.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!