RNA was isolated using RNeasy Mini kit (250) (QIAGEN, Germantown, MD), following the manufacturer’s protocol. The extracted RNA was quantified using Nanodrop 2000c Spectrophotometer (Thermo Fisher Scientific) at 260 nm. To isolate the protein from the treated cells, 100 µl of RIPA buffer was added to the cell pellet. The cell suspension was sonicated for 30 seconds with pulse set at 4 and centrifuged at 13000 rpm for 5 minutes. The supernatant containing the protein was collected and protein quantification was done by using the BCA protein assay kit (Thermo Fischer Scientific).
Rneasy mini kit 250
Manufactured by Qiagen
Sourced in Germany, United States, Spain
The RNeasy Mini Kit (250) is a laboratory equipment product designed for the purification of total RNA from various sample types. It utilizes a spin-column-based technology to efficiently isolate high-quality RNA for downstream applications.
Automatically generated - may contain errors
Lab products found in correlation
Nanodrop, by Thermo Fisher Scientific (4 mentions)
Nanodrop 2000c spectrophotometer, by Thermo Fisher Scientific (3 mentions)
High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (3 mentions)
Quantitect reverse transcription kit, by Qiagen (3 mentions)
Agilent 2100 bioanalyzer, by Agilent Technologies (3 mentions)
Bca protein assay kit, by Thermo Fisher Scientific (2 mentions)
Gotaq 2 step rt qpcr system, by Promega (2 mentions)
Oligo dt primer, by New England Biolabs (2 mentions)
Fsq 301, by Toyobo (2 mentions)
Novaseq 6000, by Illumina (2 mentions)
Goscript reverse transcription system, by Promega (1 mentions)
Itaq universal sybr green supermix, by Bio-Rad (1 mentions)
Rt2 sybr green fluor qpcr mastermix, by Qiagen (1 mentions)
Cfx96 touch real time pcr detection system, by Bio-Rad (1 mentions)
Rneasy micro kit, by Qiagen (1 mentions)
Rnase free dnase set 50, by Qiagen (1 mentions)
Nanodrop 8000 spectrophotometer, by Thermo Fisher Scientific (1 mentions)
7500 qpcr system, by Thermo Fisher Scientific (1 mentions)
Protoscript m mulv taq rt pcr kit, by New England Biolabs (1 mentions)
Taqman gene expression master mix, by Thermo Fisher Scientific (1 mentions)
24 protocols using rneasy mini kit 250
1
RNA Isolation and Protein Extraction Procedure
2
Quantitative RT-PCR for TKS5 Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
We isolated the total RNA from the cells with the QIA shredder 250 and RNeasy Mini Kit 250 (QIAGEN, Hilden, Germany), according to the manufacturer’s instructions, and we reverse transcribed 100 ng of RNA to cDNA with the GoScript Reverse Transcription System (Promega Corporation, Madison, WI, USA). We performed real-time quantitative PCR (RT-qPCR) with iTaq Universal SYBR Green Supermix (Bio-Rad Laboratories, Hercules, CA, USA), template cDNA and primers on an Applied Biosystems ViiA™ 7 Real-Time PCR System (Life Technologies GmbH, Darmstadt, Germany). We used GAPDH as an endogenous control. We expressed the relative changes in the transcript levels in the treated samples compared with the controls through the ΔΔCt method (where Ct is the cycle threshold). The primer sequences (all from 5′ 3′) were as follows: GAPDH forward: aaggtcatccctgagctgaac; GAPDH reverse: acgcctgcttcaccaccttct; TKS5 forward: ggaccccaagcaaaggatcat; TKS5 reverse: tgcccggcagtattcatcg.
3
Quantification of PRAME mRNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
2 × 106 cells per cell line were harvested, pelleted and frozen prior to the assay. RNA was extracted using the RNeasy Mini Kit (250) (Qiagen, Hilden, Germany) and cDNA was generated using High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Foster City, CA, USA), both according to the manufacturers’ instructions. PRAME specific primers were obtained from Qiagen and DNA amplification was performed using the RT2 SYBR Green fluor qPCR Mastermix (Qiagen, Hilden, Germany) and the CFX96 Touch™ Real-Time PCR Detection System (Bio-Rad Laboratories Inc., Hercules, CA, USA). All data was obtained in triplicate and the mRNA expression levels were analyzed and normalized to HTB78, BLCLs and BT474 cells, (a cell lines with very low PRAME expression), and presented as fold change.
4
Robust Quantification of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated with RNeasy® Mini Kit 250 (QIAGEN, Hilden, Germany). The homogenates of individual tissues from at least five animals, or five whole animals, of each genotype were combined together for RNA extraction. The RNA concentration was measured by using a NanoDrop (Thermo Fisher Scientific, Waltham, MA, USA). The RNA from each genotype was reverse-transcribed with the QuantiTect reverse transcription kit (QIAGEN). The cDNA was analyzed by using the SYBR Green-based qPCR method. The PCR primers for the internal control gene rpl8 were described previously [36 (link),37 (link)]. All expression data were normalized against that of the internal control gene rpl8. The expression analyses were performed at least twice, with consistent findings. The primer sequences are listed in Tables S2 and S3 .
5
Gene Expression Analysis Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Thermal cycler (MJ, US), Hybridization Oven, Hybridization Kit, Chip scanner (Agilent Technologies Santa Clara, US), Microuv/visible spectrophotometer (Nanodrop, US); RNeasy mini Kit (250), RNeasy micro Kit (50), RNase-free DNase set (50) (QIAGEN GmBH, Germany), Low Input Quick Amp Labeling Kit RNA Spike-In Kit, One Color, Gene Expression Hybridization Kit, Gene Expression Wash Buller Kit (Agilent Technologies Santa Clara, US) were used in this study.
6
Quantitative Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted with RNeasy Mini Kit (250) from Qiagen according to the manufacturer’s instructions. The RNA concentration was measured with Nanodrop 8000 spectrophotometer (Thermo Scientific) and 1 μg of RNA was used to produce cDNA with the ProtoScript M-MuLV Taq RT-PCR kit using the oligo dT primers (New England BioLabs). Semi-quantitative real-time analysis (qPCR) was done with a 7500 qPCR System (Applied Biosystems, USA) using a GoTaq 2-step RT-qPCR System (Promega) to amplify the gene of interest following the instructions provided. Primer sequences are listed in Additional file 1 : Table S1.
7
Quantitative Real-Time PCR Analysis of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from cultured cells using the RNeasy Mini kit (250) from Qiagen (Valencia, CA, USA) according to the manufacturer’s instructions. After isolation, the RNA was stored at −20°C, and the concentration and purity of the RNA was determined by measuring the absorbance at 260 and 280 nm using a spectrophotometer. Total RNA (2 µg) was reverse-transcribed using a high-capacity cDNA reverse transcription kit (Applied Biosystems, V.A. Graiciuno, Lithuania). Quantitative real-time PCR analysis was performed using the TaqMan® Gene Expression Master Mix (Applied Biosystems) and StepOne real-time PCR system (Applied Biosystems, Foster City, CA, USA), according to the manufacturer’s protocols (Gyawali et al., 2021 (link)). GAPDH was used as an internal control. The results were analyzed using the StepOnePlus software (Applied Biosystems) and expressed as Ct, the threshold cycle for target amplification (Lee et al., 2017 (link)).
8
Thyroid Gland RNA Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The mice were sacrificed with carbon dioxide and the RNA of the thyroid glands was extracted and purified using an RNA extraction kit (RNeasy Mini Kit 250, QIAGEN, Valencia, CA) and cDNA was inverted (FSQ-301, TOYOBO, Osaka, Japan). The differentially expressed genes were verified by qPCR using a Real-Time Quantitative Analyzer (QuantStudio 6 Flex Real-Time PCR System) and the results were analyzed by 2−ΔΔCT. Primers used are shown in Table 1 . The data were analyzed by one-way ANOVA using GraphPad Prism5 software. The data are expressed as mean±SEM. Comparisons of 2 sets of data were performed using the t test, and P<0.05 was considered statistically significant.
9
Quantifying Myelination Markers in Tissues
10
RNA Extraction and Quantification in Mice
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!