Crosslink immunoprecipitation experiments were conducted using a modified single-end (se)CLIP approach (Van Nostrand et al., 2017 (link)). All experiments were conducted using HEK293 cells (negative control), or HEK293 cells that express FLAG-tagged MARFΔNYN. Briefly, FLAG-tagged MARF1ΔNYN expression was induced in a 15 cm dish of HEK293 cells with 100 ng/mL of doxycycline for 12 hr. Following induction, 2 × 107 cells were lysed in iCLIP lysis buffer and sonicated (BioRuptor). Lysates were treated with RNAseI (Thermo) to shear RNA, after which FLAG-tagged MARF1ΔNYN-RNA complexes were immunoprecipitated with FLAG antibody. Stringent washes were performed, during wish RNA was dephosphorylated with FastAP (Thermo) and T4 PNK (NEB). Following dephosphorylation, a 3’ RNA adaptor was ligated onto the RNA with T4 RNA ligase (NEB). Protein-RNA complexes were resolved by SDS-PAGE, transferred to nitrocellulose membranes, and RNA was isolated from the membrane region corresponding to the migration of MARF1 and 75 kDa above. Isolated RNA was subsequently reverse transcribed with AffinityScript (Agilent) and the 3’ DNA adaptor was ligated onto the cDNA with T4 RNA ligase (NEB). Libraries were then amplified with Q5 PCR mix (NEB).
T4 rna ligase
Manufactured by New England Biolabs
Sourced in United States, China
T4 RNA ligase is an enzyme that catalyzes the formation of a phosphodiester bond between the 5' phosphate and 3' hydroxyl groups of two RNA molecules. It is commonly used in molecular biology applications for the ligation of RNA fragments.
Automatically generated - may contain errors
Lab products found in correlation
Superscript 3, by Thermo Fisher Scientific (7 mentions)
Superscript 2 reverse transcriptase, by Thermo Fisher Scientific (7 mentions)
Hiseq 2500, by Illumina (6 mentions)
T4 pnk, by New England Biolabs (6 mentions)
Rnase h, by New England Biolabs (6 mentions)
Pgem t easy vector, by Promega (4 mentions)
Superscript 4, by Thermo Fisher Scientific (4 mentions)
Trizol reagent, by Thermo Fisher Scientific (4 mentions)
Calf intestinal phosphatase, by New England Biolabs (4 mentions)
Nanodrop 1000, by Thermo Fisher Scientific (4 mentions)
Rneasy mini kit, by Qiagen (3 mentions)
Truncated t4 rna ligase, by New England Biolabs (3 mentions)
T4 polynucleotide kinase, by New England Biolabs (3 mentions)
Nextseq 500, by Illumina (3 mentions)
M mlv reverse transcriptase, by Thermo Fisher Scientific (3 mentions)
Superscript 3 reverse transcriptase, by Thermo Fisher Scientific (3 mentions)
Fastap, by Thermo Fisher Scientific (3 mentions)
Firstchoice rlm race kit, by Thermo Fisher Scientific (3 mentions)
Biotaq polymerase, by Meridian Bioscience (2 mentions)
Pcr2.1 topo ta vector, by Thermo Fisher Scientific (2 mentions)
118 protocols using t4 rna ligase
1
Crosslink Immunoprecipitation of MARF1 in HEK293
2
Circular RNA detection and sequencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
5 μg of total RNA was circularized in a 20 μl reaction using T4 RNA ligase (1x T4 RNA ligase reaction buffer, 10 units T4 RNA ligase (New England Biolabs), 1 mM adenosine triphosphate, two units Turbo DNase, 40 units RNasin RNase inhibitor) for one hour at 37°C. Each ligation reaction was subjected to phenol:chloroform extraction followed by sodium acetate/ethanol precipitation of the aqueous phase overnight at −20°C. Circularized RNA was pelleted at 20,000 g for 30 min at 4°C resuspended in 20 μl nuclease-free water. 5 μl aliquots of the circularisation reaction were subjected to reverse-transcription across the circularisation junction for 60 min at 37°C using Omniscript reverse-transcriptase (Qiagen) primed with 10 pmol of gene-specific reverse oligonucleotide, according to manufacturer’s instructions. Following reverse transcription, PCR was performed across the ligation junction using gene specific primers Fw1 and Rv1. For the ND1 and COI transcripts, a further nested PCR was performed using the Fw2 and Rv2 oligonucleotides after the initial PCR was purified using QIAquick PCR purification kit. Following PCR, products were cloned using the Zero Blunt TOPO PCR Cloning Kit for Sequencing. Clones were sequenced using M13 Forward universal sequencing primer.
3
Isolation and Characterization of Viral Small RNAs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNAs extracted from TNV-infected protoplasts or generated by digestion with Xrn1 in vitro were separated in 2% agarose gels. Bands corresponding to the svRNA were excised as gel slices and the extracted RNA was ligated to an oligonucleotide adaptor sequence containing an SbfI site (bold): 5′-GATCTGCAGCTTGAGCCTGCAGG GTGCTGCGCAGAGTTCTACAGTCCGAC using T4 RNA ligase (NEB). RT-PCR was carried out using a reverse primer complementary to the genome 3′-terminus (underlined) and containing a SalI site (bold), 5′-GCAGCACGTCGAC GGGTTCCTAGAGAGATCTCTAGG , and nested primer 5′-GCAGCTTGAGCCTGCAGGGTGC. PCR products were double-digested with SbfI and SalI and ligated into a pUC19 vector, cloned into E. coli, and individual clones were sequenced.
4
Determination of RABV Genome Terminal Sequences
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To determine the terminal sequences of RABV genomes, the viral RNA genomes isolated from PEG precipitated supernatant virions were circularized by T4 RNA Ligase. To remove the 5′-triphosphate residues from genomic RNAs prior to RNA ligation, 1 μg RNA was digested with 5 units of 5′ Pyrophosphohydrolase (RppH; New Englang Biolabs) in 20 μl reaction buffer (50 mM NaCl, 10 mM Tris-HCl, 10 mM MgCl2, 1 mM DTT, pH 7.9) and was then purified (RNeasy mini kit, QIAGEN) according to the manufacturer’s recommendations. 400 ng of RppH digested or not digested genomic RNA were ligated with 10 units T4 RNA Ligase (New England Biolabs) in 20 μl reaction buffer (50 mM Tris-HCl, 10 mM MgCl2, 1 mM DTT, 1 mM ATP, pH 7.5) for 1 h at 37 °C. The reaction was stopped by adding EDTA to a final concentration of 5 mM and 15 min incubation at 65 °C. Five μl of the ligation sample was directly used as a template for RT-PCR with SuperscriptIII reverse transcriptase (Invitrogen) and GoTaqFlexi (Peqlab) according to the manufacturer’s protocols with gene specific oligonucleotides listed in Supplementary Table S3 . PCR products were gel purified (QIAquick Gel Extraction Kit, QIAGEN) and sequenced on an ABI genetic analyzer (Applied Biosystems) using the BigDye Terminator v3.1 Cycle Sequencing Kit (LifeTechnologies) with the same oligonucleotides used for PCR amplification (see Supplementary Table S3 ).
5
Transcription Start Site Mapping
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The 5′-Rapid Amplification cDNA Ends (RACE) analysis was conducted on the selected putative sRNAs to capture their transcription start sites (TSS). Total RNA (up to 15 μg) of P. ananatis strains grown to high density (OD600 = 0.6) was extracted as above mentioned (see the section “RNA Extraction and Transcriptomic Analysis”). The resulting RNA was ligated to 300 pmol of RNA linker: GACGAGCACGAGGACACUGACAUGGAGGAGGGAGUAG AAA in the presence of RNA 5′-pyrophosphohydrolase (RppH) (New England BioLabs, Ipswich, MA, United States) and T4 RNA ligase (New England BioLabs, Ipswich, MA, United States) at 37°C for 4 h. The linker-ligated RNA was purified using Trizol-chloroform (2:1) extraction method, as described by Rio et al. (2010) (link). The resulting RNA was ethanol precipitated and suspended in 10 μl of RNase-free water. The cDNA of linker-ligated RNA was synthesized as previously described (see the section “qRT-PCR Validation of sRNA Expression”) and Gene Specific PCR (GSP) was performed using nested linker and sRNA-specific PCR primers (Table 2 ). The GSP using genomic DNA was used as a control and resulting bands from 5′-RACE were gel-purified and cloned into pJET1.2 blunt (Thermo Fischer Scientific Baltics UAB, Vilnius, Lithuania) prior to sequencing.
6
ChrCAP-seq Protocol for Capped RNA Enrichment
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
ChrCAP-seq experiments were modified from a previous method (Pelechano et al., 2015 (link)). Briefly, 50ug of FACs sorted chromatin associated RNA were treated with Turbo DNase I (Life technologies) according to manufacturer’s instructions. RNA was recovered after acid phenol treatment. Sequential order of enriching for capped RNA started by first, the removal of 5′P RNA. RNA samples were treated with 1U Terminator 5′P dependent exonuclease (Epicenter, TER51020) before recovering the RNA through acid phenol treatment. The samples were then subjected to 30U Calf Intestine Phosphatase treatment (NEB, M0290S) to further remove 5′P and 5′PPP uncapped RNA before recovering the cap-enriched RNA by acid phenol treatment. The removal of 5′cap from RNA was performed using Cap-Clip Acid pyrophosphatase (CellScript, C-CC15011H). The resulting 5′P RNA enables single stranded RNA ligation of adaptor rp5: (5′CTTTCCCTACACGACGCTCTTCCGATrCrUrNrNrNrNrNrNrNrN-3′) with T4 RNA ligase (NEB M0204S). The resulting RNA was then recovered by acid phenol treatment and used for library preparation. These RNA libraries were prepared with the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (NEB) according to the manufacturer’s guidelines. Libraries were sequenced on an Illumina NEXTseq 550 with 150 bp single end reads.
7
RNA Ligation-Coupled RT-PCR for Emi2 Detection
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA-ligation-coupled RT-PCR was performed as described previously with some modifications (Charlesworth et al., 2002 (link); Igea and Méndez, 2010 (link)). 4 μg of total oocyte RNA were ligated to 0.5 μg of SP2 anchor primer (5’-P-GGTCACCTCTGATCTGGAAGCGAC-NH2-3’) in a 10 μl reaction using T4 RNA ligase (New England Biolabs), following manufacturer’s indications. RNA-ligation reaction was reverse transcribed with the RevertAid First Strand cDNA Synthesis Kit (Thermo Fisher Scientific), using 0.5 μg ASP2T antisense primer (5’- GTCGCTTCCAGATCAGAGGTGACCTTTTT-3’) in a reaction volume of 50 μl. 0.6 μl of cDNA were used to do gene-specific PCR reactions (30 μl) with BioTaq Polymerase (Bioline, London, UK). The primer used for Emi2 PCR was 5’- GTATATACATTCATTTGTTCAATGT TGCC-3’. 7.5 μl of PCR were loaded in 1.7% agarose gel and a Southern Blot was performed, using as probe the radiolabeled primer 5’- TGCAGCTAAATAGGTAGACGACATAC-3’.
8
RNA-seq Analysis of TERC Transcripts
9
Poly(A) Tail Assay for Oocyte mRNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Poly(A) tail assays were performed as described (Rassa et al., 2000 (link)) with a few modifications. Total RNA was extracted from 50 GV or MII oocytes as described above. After denaturation at 70°C, the mRNA was ligated with 50 pmol of primer GB-135 (5′-P-GGTCACCTTGATCTGAAGC-NH2-3′) (Eurogentec, Maastricht, the Netherlands) at 37°C for 1 h in a total volume of 20 µl using T4 RNA ligase (New England Biolabs, Ipswich, MA, USA). GB-135 contained a 3′ amino modification to block ligation at this end. To inactivate RNA ligase, samples were boiled at 100°C for 5 min and cooled on ice. Reverse transcription was performed as described above using 50 pmol of primer GB-136 (5′-GCTTCAGATCAAGGTGACCTTTTT-3′) (Eurogentec), and the anchored cDNA was used for amplification. First round amplification was performed using a gene-specific primer (P1) (Supplementary Table S2 ) and GB-136. The product of the first round amplification was used as template for the second round amplification, using a gene-specific primer starting after the 3′ site of P1 (P2) (Supplementary Table S2 ) and GB-136. The PCR was performed as described above with 40 cycles for first round amplification and 20 cycles for second round amplification. Samples were electrophoresed on 1.0% agarose (Eurogentec) gels and visualised with ethidium bromide (Invitrogen).
10
Circular RNA Mapping and Sequencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Five microgram of total RNA were circularized with 40 U of T4 RNA ligase (New England Biolabs), following the manufacturer's instructions. Circularized RNA were phenol extracted and precipitated in one volume of isopropanol, for 2h at −20°C. Circularized RNA were resuspended in 14.5 μl of water and first strand complementary DNA (cDNA) synthesis was done for 3 h at 40°C using 400 U of M-MLV reverse transcriptase (Fermentas), 8 mM of random hexamers (Eurofins), 1X M-MLV buffer, 0.5 mM dNTPs and 40 U of Riboblock RNase inhibitor (Fermentas). The obtained cDNA were diluted four times, and 5 μl of the obtained cDNA solution were used for PCR amplification with divergent primers. The primers used for mapping nad1 exon 1, exons 2–3 and exons 4–5 precursor transcripts are listed in Supplementary Table S1 . Amplified PCR products were gel purified, cloned into pCR2.1®-TOPO® TA vector (ThermoFisher Scientific) and inserts of independent recombinant plasmids were sequenced after Escherichia coli transformation.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!