For establishment of cell lines stably expressing WT or mutant forms of p53, the constructed plasmid vectors described above or the empty plasmid vector (EV) were first introduced into HEK293T cells (ATCC #CRL-1573) with the use of a Retrovirus Packaging Kit Ampho (#6161, Takara Bio) and the Lipofectamine 3000 reagent (Invitrogen, Carlsbad, CA, USA). The culture supernatants containing the recombinant retroviruses were then passed through a 0.45-μm filter, and the filtrate was incubated overnight at 4 °C with a Retro-X Concentrator (Clontech, Shiga, Japan) and then centrifuged at 1500 × g for 45 min at 4 °C for isolation of virus pellets. PC9/p53KO, HCC4006/p53KO, or H1975/p53KO cells were infected with the retroviruses for 24 h in the presence of polybrene (Nacalai Tesque, Kyoto, Japan) at 8 μg/ml and were then cultured in growth medium for an additional 24 h before selection by culture in the presence of puromycin (Invitrogen) at 1 μg/ml. For establishment of cell lines for doxycycline-inducible p53 expression, GP2-293 packaging cells of the Retro-X Tet-One Inducible Expression System (#634307, Takara Bio) were used to produce retroviruses instead of HEK293T cells.
Retrovirus packaging kit ampho
Manufactured by Takara Bio
Sourced in United States, Japan
The Retrovirus Packaging Kit Ampho is a laboratory product designed for the production of recombinant retroviruses. It contains the necessary components to generate high-titer retroviral supernatants for gene delivery and expression applications.
Automatically generated - may contain errors
Lab products found in correlation
Retro x concentrator, by Takara Bio (2 mentions)
Polybrene, by Nacalai Tesque (2 mentions)
Primestar hs dna polymerase, by Takara Bio (2 mentions)
In fusion hd cloning kit, by Takara Bio (2 mentions)
Hek293t cell, by American Type Culture Collection (1 mentions)
Puromycin, by Thermo Fisher Scientific (1 mentions)
Lipofectamine 3000 reagent, by Thermo Fisher Scientific (1 mentions)
Retro x tet one inducible expression system, by Takara Bio (1 mentions)
Fluorescence activated cell sorting aria, by BD (1 mentions)
Opti mem, by Thermo Fisher Scientific (1 mentions)
Dulbecco s modified eagle s medium high glucose, by Nacalai Tesque (1 mentions)
Lipofectamine ltx, by Thermo Fisher Scientific (1 mentions)
Plus reagent, by Thermo Fisher Scientific (1 mentions)
Pires egfp vector, by Thermo Fisher Scientific (1 mentions)
Pbabe cd44s, by Addgene (1 mentions)
Plncx myr ha akt1, by Addgene (1 mentions)
10 protocols using retrovirus packaging kit ampho
1
Stable Expression of p53 Variants
2
Overexpression of IL13RA2 in Caki-1 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Full-length IL13RA2 cDNA was amplified by PCR from Caki-1 cell cDNA using PrimeSTAR HS DNA polymerase (Takara Bio, Shiga, Japan) and cloned into the pBABE-puro retroviral vector. The oligonucleotide sequences used in the construction of the expression construct were as follows: IL13RA2, 5′-CACCATGTATCCATATGATGTTCCAGATTATGCTGGATCCGCTTTCGTTTGCTTGGCTATCGGATGCTTATATAC-3′ and 5′-ACACCCTAACTGACACACATTCCCAGGGTCGACTCATGTATCACAGAAAAATTCTGGAATCATTTTTG-3′. The PCR products were inserted into pBABE-puro vector at BamH1/Xho1 sites using an Infusion-HD Cloning Kit (Takara Bio, Shiga, Japan). G3T-hi packaging cells were infected with retroviral plasmids using a Retrovirus Packaging Kit (Ampho, Takara Bio). These experiments were performed according to the manufacturer’s instructions.
3
Generation of CCL2-overexpressing Cell Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Full‐length CCL2 cDNA was amplified by PCR from 786‐O and UMRC2 cell cDNA using PrimeSTAR HS DNA polymerase (Takara Bio, Shiga, Japan) and cloned into the pBABE‐puro retroviral vector. The oligonucleotide sequences used in the construction of the expression construct were as follows: CCL2, 5′‐CGCGGATCCATGAAAGTCTCTGCCGCCCTTCT‐3′ and 5′‐GACGTCGACTCAAGTCTTCGGAGTTTGGGTTT‐3′. The PCR products were inserted into pBABE‐puro vector at BamH1/Sal1 sites using an Infusion‐HD Cloning Kit (Takara Bio). G3T‐hi packaging cells were transfected with retroviral plasmids using a Retrovirus Packaging Kit (Ampho; Takara Bio). These experiments were performed according to the manufacturer's instructions.
4
Stable DDX56 Knockdown in CaR-1 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DDX56 human shRNA retroviral untagged vector plasmid (DDX56 Human shRNA Plasmid Kit) was obtained from OriGene Technologies. A control shRNA retroviral vector was also obtained from OriGene Technologies. Retrovirus was produced in 293T cells using Retrovirus Packaging Kit Ampho (TaKaRa) and the media collected after 48 hours for transduction of CaR‐1 cells. Cells were transduced with retroviral supernatant and then selected with 2.5 μg/mL puromycin to generate cells with stable knockdown of DDX56.
5
NOTCH4 Expression in Breast Cancer Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cells were transfected with a pMscvPuro vector in RPMAI1640/10% FBS containing 0.2 µg ml−1 puromycin. Breast cancer cells were also infected with the retrovirus containing GFP, which was obtained by transfecting pRS-puro-GFP plasmid in G3T-hi cells using a Retrovirus Packaging kit Ampho (Takara Bio, Shiga, Japan), and GFP+ cells were confirmed with fluorescence activated cell sorting ARIA (BD Biosciences, Franklin Lakes, NJ, USA). NOTCH4 expression was confirmed with western blotting following a standard protocol using primary antibodies against human NOTCH4 (abcam, ab-33163 1:300) conjugated to horseradish peroxidase secondary antibody. Blots were developed using enhanced chemiluminescence (Supersignal West Pico, Pierce).
6
Generation of Optogenetic RANK Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Recombinant retroviruses were prepared using Retrovirus Packaging Kit Ampho (TaKaRa Bio), according to the manufacturer’s instructions. One day before transfection, HEK293T cells (1 × 106 cells/dish) were plated in collagen I-coated 60-mm dishes (IWAKI, Tokyo, Japan), in Dulbecco’s modified Eagle’s medium (high-glucose, Nacalai Tesque) containing 10% FBS. The retroviral vectors and packaging plasmids, pGP and pE-ampho, were transfected into HEK293T using Lipofectamine™ 2000. The medium was replaced with fresh medium 24 h after transfection. After 2 d, the supernatants were filtrated through a 0.45-μm filter, and the recombinant retroviruses were concentrated using the Retro-X™ Concentrator (TaKaRa Bio), according to the manufacturer’s instructions. The viruses were suspended in Opti-MEM™ (Thermo Fisher Scientific). RAW264.7 cells were transduced with the concentrated viruses and polybrene (Nacalai Tesque). Six hours after transduction, the medium was replaced with fresh medium, and 2 d later, it was replaced with a culture medium containing G418 (Nacalai Tesque) (400–500 μg/mL) for > 7 d. We cultured single cells to establish cell lines (Opto-RANKc and Opto-RANKm cells) using limiting dilution of G418-selected cells in 96-well plates.
7
Cloning and Expression of EGFP and Emerald Luc
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The cDNA of EGFP from pIRES-EGFP Vector (Invitrogen, Carlsbad, CA, USA) and Emerald Luc (Eluc) from Emerald Luc Vector (ELV-101; Toyobo) were cloned into MaRXIVf Puro retroviral vector (Fig. S2 ). All cDNA were sequenced. Transfection was carried out using Lipofectamine LTX and PLUS Reagent (Invitrogen) and retroviral infection was carried out using Retrovirus Packaging Kit Ampho (Takara: Otsu, JAPAN) according to the manufacturer's instructions. The cells were then selected in puromycin.
8
Retroviral Transduction of CD44s in MCF7 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Retroviral particles were produced in HEK 293T cells following the transfection of the cells with the CD44s retroviral expression plasmid (pBabe-CD44s, Addgene) or the empty vector (pBabe) and Retrovirus Packaging Kit Ampho (Takara) as described by the manufacturer. MCF7 cells in 6-well plates were transduced with retroviral particles containing the blank pBabe or pBabe-CD44s plasmid in the presence of 8 μg/mL hexadimethrine bromide. Transduction was continued for 48 h and followed by a 24 h-recovery in complete medium. For the selection of stable transgene-expressing cells, puromycin (2 μg/mL) incubation was continued for up to 4 weeks.
9
Constructing EpCAM-specific CAR and Akt co-expressing retroviruses
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
PLNCX-myr-HA-Akt1 (William Sellers, Addgene plasmid 9005) and pLNCX-HA-Akt1 (William Sellers, Addgene plasmid 9004) were obtained from Addgene [13 (link)]. PLNCX empty vector was used as the control retrovirus. To construct EpCAM specific CAR and Akt co-expressing construct, HindIII/HpaI/BglII-IRES-XhoI/SalI/ClaI sequence was synthesized (IRES sequence corresponds to 1119–1693 of pIRES-G, with 1346G → C) and inserted into HindIII/ClaI multiple cloning sites of pLNCX retroviral vector to make pLNCX-IRES. EpCAM specific CAR consisting of an anti-EpCAM scFv (sequence corresponds to Genebank identifier AJ564232.1) [14 (link)], part of the extracellular domain and the entire transmembrane and intracellular domains of CD28, and the cytoplasmic domain of CD3ζ (the CD28 and CD3ζ sequence included corresponds to Genebank identifier HM852952.1) [15 (link)] was synthesized and inserted into HindIII/BglII of pLNCX-IRES to make pLNCX-CAR. Akt and myr-Akt were cloned from pLNCX-HA-Akt1 and PLNCX-myr-HA-Akt1 respectively, and inserted into XhoI/ClaI of pLNCX-CAR to make pLNCX-CAR-Akt and pLNCX-CAR-myr-Akt co-expressing constructs. Retroviruses were prepared using Retrovirus Packaging Kit Ampho (TaKaRa) and 293 T packaging cell line, following the manufacturer’s instruction.
10
Silencing ETV6 Expression in OCUM-9 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Nucleotides corresponding to a shRNA against ETV6 were synthesized based on the shRNA (#sh‐9528) from DECIPHER project (http://www.decipherproject.net ), and inserted into the pMKO.1‐GFP vector, which was a gift from Dr William Hahn (Addgene plasmid #10676; http://n2t.net/addgene:10676 ; RRID:Addgene_10676). The resultant pMKO.1‐shETV6‐GFP allows the simultaneous expression of shETV6 and GFP. The control shRNA sequence is 5′‐UGGUUUGCAUGUUGUGUGGCUCGAGUCACACAACAUGUAAACCA‐3′.
The pMKO.1‐shETV6‐GFP plasmid together with packaging plasmids (Retrovirus Packaging Kit Ampho, Takara Bio) was transiently transfected into HEK293 cells, and the culture supernatant containing the recombinant retrovirus was used to infect OCUM‐9 cells for 2 days. Real‐time RT‐PCR was conducted with a primer set (5′‐TATGAGAAAATGTCCAGAGCCCTG‐3′ and 5′‐TTCATCCAGCTCCTGGGACTCTAG‐3′) for ETV6, and with another primer set (5′‐GTCAGTGGTGGACCTGACCT‐3′ and 5′‐TGAGCTTGACAAAGTGGTCG‐3′) for GAPDH.
The pMKO.1‐shETV6‐GFP plasmid together with packaging plasmids (Retrovirus Packaging Kit Ampho, Takara Bio) was transiently transfected into HEK293 cells, and the culture supernatant containing the recombinant retrovirus was used to infect OCUM‐9 cells for 2 days. Real‐time RT‐PCR was conducted with a primer set (5′‐TATGAGAAAATGTCCAGAGCCCTG‐3′ and 5′‐TTCATCCAGCTCCTGGGACTCTAG‐3′) for ETV6, and with another primer set (5′‐GTCAGTGGTGGACCTGACCT‐3′ and 5′‐TGAGCTTGACAAAGTGGTCG‐3′) for GAPDH.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!