The largest database of trusted experimental protocols

Miscript pcr kit

Manufactured by Qiagen
Sourced in United States

The MiScript PCR Kit is a laboratory equipment product manufactured by Qiagen. It is designed for the detection and quantification of microRNA (miRNA) expression. The kit includes reagents and components necessary for the reverse transcription and real-time PCR amplification of miRNA targets.

Automatically generated - may contain errors

19 protocols using miscript pcr kit

1

Real-Time Quantification of Gene and MicroRNA Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was isolated from tissue samples or cultured cells using Qiazol reagent (Qiagen, Gaithersburg, MD, USA) or TRIzol reagent (Invitrogen, Carlsbad, CA, USA). RNA was reverse‐transcribed into miRNA cDNA or total cDNA using the Prime Script miRNA cDNA synthesis kit (Qiagen) or PrimeScript RT kit (Qiagen), and then subjected to quantitative RT‐PCR (qRT‐PCR). mRNA or miRNA expression was determined by qPCR on a Q6 real‐time PCR System (Applied Biosystems, Carlsbad, CA, USA) using SYBR Green Master Mix (4309155, Applied Biosystems) or the miScript PCR Kit (Qiagen), using GAPDH or U6, respectively, as the internal loading control. Reverse transcription and PCR were performed as described in our previous report.55 Specific primers for human MMP9 (Forward: 5′‐TTC CAA ACC TTT GAG GGC GA‐3′ and Reverse: 5′‐CTG TAC ACG CGA GTG AAG GT‐3′), human SMURF1 (Forward: 5′‐AAC TGA AAC CCA ATG GCA GAA ATGT‐3′ and Reverse: 5′‐TTG CCA GAA CCA CCG CAC GAT G‐3′), and human GAPDH (Forward: 5′‐GAC TCA TGA CCA CAG TCC ATG C‐3′, Reverse: 5′‐CAG GTC AGG TCC ACC ACC ACT GA‐3′) were used for PCR amplification. The primer for miR‐516a (5′‐TGC TTC CTT TCA GAG GGT‐3′) was synthesized by Sunny Biotechnology (Shanghai, China), and U6 was used as the internal loading control through the primer provided in the miScript PCR Kit. The data were analyzed as previously described.55
+ Open protocol
+ Expand
2

Profiling miRNA Expression Using Taqman PCR

Check if the same lab product or an alternative is used in the 5 most similar protocols
The total RNA of cells was extracted using a TRIzol reagent in accordance with the instructions. The purity and content of RNA were determined using a NanoDrop1000 spectrophotometer (ThermoFisher Scientific). A miScript II RT kit (Qiagen) was used for reverse transcription in accordance with the manual. MiR-211-5p mRNA expression was detected using Taqman specific PCR primers (Assay # 002285) and a miScript PCR Kit (Qiagen) following the instructions of the manufacturers. The thermocycler conditions were 95 °C for 10 min, 40 cycles of 95 °C for 12 s, and 60 °C for 40 s. U6 and GAPDH were used as internal controls. Quantification was performed using the2−ΔΔCt method. The primer sequences are listed in Table 1.

Primers Used in the Study

GeneForward Primer (5ʹ-3ʹ)Reverse Primer (5ʹ-3ʹ)
KCNQ1OT1ACTCACTCACTCACTCACTCTGGCTCCTTCTATCACATT
CHI3L1GTGAAGGCGTCTCAAACAGGGAAGCGGTCAAGGGCATCT
GAPDHGCTCTCTGCTCCTCCTGTTCACGACCAAATCCGTTGACTC
+ Open protocol
+ Expand
3

miRNA Expression Profiling of Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was reverse transcribed using the miScript Reverse Transcription Kit (Qiagen, Valencia, CA). RT-qPCR was performed using the miScript PCR Kit (Qiagen). Experiments were normalized to U6. Results were reported as RQ with respect to a calibrator sample using the 2-ΔΔCt method. MiR-200a, miR-200b, miR-200c and U6 kits were purchased from Biomics biotech (NanTong).
+ Open protocol
+ Expand
4

Quantifying Cytoskeleton Regulators Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
The total RNA was extracted from cells using TRIzol™ Reagent (Invitrogen, Carlsbad, CA, cat. no. 15596018) according to the manufacturer’s instructions. About 1 μg of RNA was reversely transcribed into cDNA with the help of a commercial miScript Reverse Transcription Kit (Qiagen, Valencia, CA, USA). qPCR was performed using miScript PCR Kit (Qiagen) on ABI PRISM 7900HT. The target gene relative expression was calculated using the 2-ΔΔCt method. The primers used in the present study were as follows: ROCK-1: forward primer ACCTGTAACCCAAGGAGATGTG and reverse primer CACAATTGGCAGGAAAGTGG; CDC42, forward primer, ATGCAGACAATTAAGTGTGTTGTTGTGGGCGA, reverse primer, TCATAGCAGCACACACCTGCGGCTCTTCTT; Rac1, forward primer ATGCAGGCCATCAAGTGTGTGG, reverse primer TTACAACAGCAGGCATTTTCTC.
+ Open protocol
+ Expand
5

Quantifying miR-148a Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA containing miRNAs was extracted using the mirVana miRNA Isolation Kit (Ambion) and reverse transcribed into cDNA using the miScript II RT Kit (Qiagen). qPCR was performed using the miScript PCR kit (Qiagen) on a ViiA 7 Real Time PCR System (Applied Biosystems, Grand Island, NY). Expression of miR-148a was normalized to RNU6-2_1 and was analyzed using the efficiency corrected ΔCt method. Primer assays; RNU6-2_1 and miR-148a (Qiagen).
+ Open protocol
+ Expand
6

Quantitative miRNA expression analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
The candidate miRNAs were further validated by Q-PCR. 1 μg of total RNA was reversely transcribed with miScript Reverse Transcription Kit (Qiagen, Valencia, CA). Real-time PCR was conducted with miScript PCR Kit (Qiagen, Valencia, CA) on PRISM 7900HT. The relative expression was normalized to 5s rRNA and calculated by the 2−ΔΔCt method.
+ Open protocol
+ Expand
7

Quantification of miR-27a by qRT-PCR

Check if the same lab product or an alternative is used in the 5 most similar protocols
Cells were used for total RNA extraction with the miRNeasy Mini Kit (QIAGEN, Valencia, CA, USA). One microgram total RNA was used for RT. miR-27a was determined by the QuantStudio Real-Time PCR system (Applied Biosystems, Foster City, CA, USA) with an miScript PCR kit (QIAGEN, Valencia, CA, USA). The primer for the microRNA assay was purchased from Invitrogen (Grand Island, NY, USA), and U6 was used for the internal control. The initial activation was performed at 95°C for 15 min, followed by 40 cycles (denaturation at 95°C for 15 s, annealing at 55°C for 30 s, and extension at 70°C for 30 s).
+ Open protocol
+ Expand
8

Quantification of RNA Expression Levels

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was extracted using the TRIzol reagent (Invitrogen, 15596018) as described in the manufacturer′s instructions, and cDNAs were synthesized with the SuperScript™ First-Strand Synthesis system (Invitrogen, 18091200). The target mRNA content in cells was measured by fluorescence quantitative PCR. The primers used in this study were as follows: human BECN1 (forward, 5′-TCA CCA TCC AGG AAC TCA C-3′; reverse, 5′-GGA TCA GCC TCT CCT CCT CT-3′), and human GAPDH (forward, 5′-GAC TCA TGA CCA CAG TCC ATG C-3′; reverse, 5′-CAG GTC AGG TCC ACC ACT GA-3′).
For miRNA determination, total miRNAs were extracted from cells using the miRNeasy Mini Kit (Qiagen, 218161), and miRNA expression was evaluated by using a Q6 real-time PCR system (Applied Biosystems) and the miScript PCR Kit (Qiagen). The primer for MIR516A (5′-TGC TTC CTT TCA GAG GGT-3′) was synthesized by Sunny Biotechnology, and RNU6 was used as an internal loading control with the primer provided in the miScript PCR Kit. Data were analyzed as described in a previous publication [60 (link)].
+ Open protocol
+ Expand
9

Total RNA Isolation and qRT-PCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was isolated by Trizol reagent (Invitrogen) according to the manufacturer’s instructions. For mRNA analysis, qRT-PCR was performed using Power SYBR_ green PCR master mix (Applied Biosystems) on an ABI 7500 series PCR machine Applied Biosystems using the specific primers (Supplementary Table 3). For miR-378a-3p expression assay, total RNA was reverse transcribed using the miScript Reverse Transcription Kit (Qiagen, Valencia, CA). qRT-PCR amplification for miR-378a-3p was performed using the miScript PCR Kit (Qiagen) using the specific primers (Supplementary Table 3). Experiments were normalized to U6.
+ Open protocol
+ Expand
10

Profiling microRNA Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total microRNA was extracted using the miRNeasy Mini Kit (Qiagen, Valencia, CA, USA). Total RNA (1 μg) was used for reverse transcription. Analysis of miR‐203, miR‐106a, miR‐106b, miR‐429, miR‐93, miR‐20a, miR‐20b, miR‐17, miR‐200c, miR‐125, miR‐320a, miR‐320b, miR‐320c, miR‐320d, and miR‐4429 expression was conducted using the 7900HT Fast Real‐time PCR system (Applied Biosystems) with the miScript PCR kit (Qiagen). The primers for microRNA were purchased from Invitrogen, and U6 was used as a control. Cycle threshold (CT) values were determined, and the relative expression of microRNA was calculated using the values of 2−ΔΔCT.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!