Miscript pcr kit
The MiScript PCR Kit is a laboratory equipment product manufactured by Qiagen. It is designed for the detection and quantification of microRNA (miRNA) expression. The kit includes reagents and components necessary for the reverse transcription and real-time PCR amplification of miRNA targets.
Lab products found in correlation
19 protocols using miscript pcr kit
Real-Time Quantification of Gene and MicroRNA Expression
Profiling miRNA Expression Using Taqman PCR
Primers Used in the Study
Gene | Forward Primer (5ʹ-3ʹ) | Reverse Primer (5ʹ-3ʹ) |
---|---|---|
KCNQ1OT1 | ACTCACTCACTCACTCACT | CTGGCTCCTTCTATCACATT |
CHI3L1 | GTGAAGGCGTCTCAAACAGG | GAAGCGGTCAAGGGCATCT |
GAPDH | GCTCTCTGCTCCTCCTGTTC | ACGACCAAATCCGTTGACTC |
miRNA Expression Profiling of Cells
Quantifying Cytoskeleton Regulators Expression
Quantifying miR-148a Expression
Quantitative miRNA expression analysis
Quantification of miR-27a by qRT-PCR
Quantification of RNA Expression Levels
For miRNA determination, total miRNAs were extracted from cells using the miRNeasy Mini Kit (Qiagen, 218161), and miRNA expression was evaluated by using a Q6 real-time PCR system (Applied Biosystems) and the miScript PCR Kit (Qiagen). The primer for MIR516A (5′-TGC TTC CTT TCA GAG GGT-3′) was synthesized by Sunny Biotechnology, and RNU6 was used as an internal loading control with the primer provided in the miScript PCR Kit. Data were analyzed as described in a previous publication [60 (link)].
Total RNA Isolation and qRT-PCR Analysis
Profiling microRNA Expression
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!