Mint cdna synthesis kit

Tasmanian devil tissue samples were collected under Animal Ethics permits DPIPWE AEC No. 21/2007-08. Spleen and lymph node RNA was extracted from frozen tissue samples (n = 1 per tissue) using QIAGEN RNeasy Plus Micro Kit. The concentration of extracted RNA was measured on a NanoDrop (spleen 54 ng/ul, A260/A280 2.00; lymph node 32 ng/ul, A260/A280 1.84) and the quality was checked by visualising on a denaturing TAE gel. Double-stranded cDNA libraries were synthesized using Evrogen MINT cDNA synthesis kit, normalised with Evrogen TRIMMER cDNA normalization kit, and amplified using Clontech Advantage 2 PCR kit.

Pooled reads from the M. balthica transcriptome were downloaded from the NCBI SRA database (Accession SRX145744‐6; Pante et al., 2012) and imported into CLC Genomic Workbench 8.0.3 (CLC Bio). We trimmed the raw reads for a maximum of two ambiguous nucleotides, a minimum PHRED score of 20, and a minimum length of 50 bp. Additionally, we trimmed out short population‐specific 5′ repeats and adapters from the original MINT cDNA Synthesis Kit (Evrogen) used to make the cDNA library.
Trimmed reads were assembled in CLC 8.0.3 with default settings, and were remapped with a length fraction of 0.5 and a similarity fraction of 0.8 as these criteria yielded the most contigs with two or more contributing reads. We used less stringent parameters than Pante et al. (2012) in creating the transcriptome reference to avoid excluding informative SNPs due to genetic differences between M. balthica and M. petalum. We kept contigs with a minimum of two contributing reads and retained high‐quality singletons.
We filtered out duplicate contigs in CLC 8.0.3 by performing a BLASTn search of the transcriptome assembly against itself. Sequences were discarded if they were a perfect match to another, longer sequence. We retained only representative contigs and singletons to create a partial reference transcriptome for analysis of Illumina reads.

Total RNA was extracted from blood cells of S. rustica using TRI Reagent (Sigma) and reverse-transcribed with MINT cDNA synthesis kit (Evrogen) according to the manufacturer’s instructions. MINT RACE cDNA Amplification Set (Evrogen) was used for 3′ and 5’ RACE. For 3’RACE, nested degenerate oligonucleotide primers were designed using the iCODEHOP algorithm [64 (link)] on the basis of the determined amino acid sequence (Table 3; #1, 2). Primers for 5′RACE (Table 3; #3, 4) were based on the DNA sequence obtained in 3’RACE. Both 3′ and 5’PCR products were cloned in pAL2-T vector, using Quick-TA kit (Evrogen, Russia), and Sanger sequenced in Evrogen.Table 3

Oligonucleotide primers used in the study

	Primer	Sequence 5′-3′
1	Sr_P26_3’_F1	ggnaaywsntayathmng
2	Sr_P26_3’_F2	tasttayattcgttgt
3	Sr_P26_5’_R1	cattgtgccaagttcccgag
4	Sr_P26_5’_R2	ccgagcaatggttgctgttta

h = a,c,t; y = c,t; s = c,g; n = a,g,c,t; m = a,c; w = a,t. Bold letters with underscore – overlaying parts of nested primers

Total RNA was extracted from root samples using the hot borate method [90 (link)]. Equal amount of root tissue from susceptible genotypes was combined as one susceptible control for RNA extraction, whereas root tissue from infested samples was equally combined for RNA preparation. After mRNA purification using GenElute mRNA miniprep kit (Sigma), six cDNA libraries were constructed using Mint cDNA synthesis kit (Evrogen). They are DP90 and SG747 uninfested cDNA library (DSU), DP90 and SG747 infested cDNA library (DSI), LONREN-1 uninfested cDNA library (L1U), LONREN-1 infested cDNA library (L1I), BARBREN-713 uninfested cDNA library (B713U), and BARBREN-713 infested cDNA library (B713I) (S1 Fig). The constructed libraries were sequenced on illumina 2000 HiSeq sequencer at the Genomics Core Facility at Emory University. Raw sequencing data is available for download at NCBI Sequence Read Archive under BioProject: PRJNA275155 (BioSamples: SAMN03381308; SAMN03381306; SAMN03381268; SAMN03381265; SAMN03381261; and SAMN03339739).

5′-RACE (rapid amplification of cDNA 5′-end) is a method that allows amplification of an unknown sequence on the 5′-end of a specific mRNA, using a primer designed to anneal to a known mRNA part and a universal adaptor primer. RNA extracted from the CNS of a single naive snail was used in this experiment. We used the SMART approach [48 (link),49 (link)] to prepare first-strand cDNA and anchor it with the adaptor sequence in a single step. cDNA synthesis was followed by Step-Out RACE procedure (a specific variant of nested PCR) [50 (link)] to amplify the 5′-end of the sequence. Reverse transcription paired with flanking of cDNA with adaptor sequences was performed with Mint cDNA synthesis kit (Evrogen, Moscow, Russia) according to the manufacturer’s protocol. cDNA was pre-amplified with a single adaptor-specific primer according to Evrogen’s protocol before being used as a template for nested PCR. Three rounds of nested PCR were performed with Mint RACE primer set and Encyclo polymerase mix (Evrogen, Moscow, Russia) using PCR programs recommended by Evrogen. Primer annealing temperature was 62 °C in every reaction. PCR products were visualized using 1% agarose gel electrophoresis.

cDNA expression library was prepared by the SMART approach from total embryonic RNA with a Mint cDNA synthesis kit (Evrogen, Russia). cDNA gene fragments were isolated from the library by PCR with gene-specific primers (see Table 1). Primers were designed based upon sequences obtained from the sequenced transcriptome (Illumina) of D. pumila^{35 (link)}. Amplified fragments were cloned into the pAL-TA vector (Evrogen, Russia). Digoxygenine‐labeled antisense RNA probes were generated from gene fragments, which were amplified from plasmids with D. pumila genes.Table 1

PCR and qPCR primers used in this study.

Gene	Direct primer 5' ‑> 3'	Reverse primer 5' ‑> 3'
DpBra1 in situ probe	TTGGTGGCGACAGCGAAGAA	CGGCCACGTGTTGTTTTGAATG
DpBra2 in situ probe	GAACGGAGAGGGCAAAGACAAAC	GACGGCGAATATGGGGAACAAAT
DpBra3 in situ probe	AATAATTCTTCACCGTCCAACAGG	CGCGCTTTTCGTGATAGATAGG
XlTubb2b.S (β-tubulin) qPCR	GATCCTACCGGCAGTTACCA	TGACAGAGTCCATTGTGCCT
XlActc1.L (cardiac actin) qPCR	CTATGTGGCTTTGGACTTTGAG	GCTGTTGTAGGTAGTTTCATG GA
XlMyod1.S qPCR	AGTGACAGCCCAAATGACTC	AGAAGGGATGGTGATTACTCTC
XlEF1a qPCR	CCCTGCTGGAAGCTCTTGAC	GGACACCAGTCTCCACACGA
XlODC qPCR	GGGCTGGATCGTATCGTAGA	TGCCAGTGTGGTCTTGACAT