Pezx mt06

To confirm the miRNA-mRNA interactions, human CYP1A2 (HmiT003774) and CYP3A4 (HmiT055335) 3′ UTR target clones in pEZX-MT06 were purchased (GeneCopoeia, Rockville, MD). HEK293T cells were seeded in 96-well plates (3 × 10⁴ cells/well) for 24 h. HEK293T cells were co-transfected in OPTI MEM media (ThermoFisher Scientific, Carlsbad, CA) with 200 ng of 3′ UTR luciferase reporter plasmids and miR-122 mimic, miR-122 inhibitor or negative control plasmid pEZX-MT06 (GeneCopoeia, Rockville, MD) with Attractene transfection reagent (Qiagen, Valencia, CA). Firefly and renilla luciferase activities were measured 24 h after transfection using the Luc-Pair Duo-Luciferase Assay Kit 2.0 (GeneCopoeia, Rockville, MD). Data represent the ratio of firefly luciferase activity to that of Renilla.

To determine the transfection efficiency of miR-92a-3p on primary skeletal muscle cells, the untranslated region of human SOCS5 was cloned into a firefly/renilla Duo-Luciferase reporter vector (pEZX-MT06) (GeneCopoeia, Rockville, MD, USA). Primary human skeletal muscle cells (Lonza Australia Pty Ltd, Toowong, QLD) were differentiated for five days and transfected using Lipofectamine3000 (Thermo Fisher Scientific, Australia). Transfections were performed using 150 ng of dual luciferase reporter plasmids and a 10 nM concentration of synthetic mir-92a-3p mimic (MSY0000092, Qiagen, Australia). Transfections with pEZX-MT06 control plasmid (GeneCopoeia, Rockville, MD, USA) and All Stars Negative Control miRNA (Qiagen, Australia) were used as controls. Dual luciferase assays were performed Luc-Pair Duo-Luciferase Assay Kit 2.0 (GeneCopoeia, Rockville, MD, USA) as per the manufacturer’s protocol at 48 and 72 h. Firefly luciferase was normalized to Renilla luciferase control.

The vectors (pEZX-MT06, GeneCopoeia, USA) harboring wild-type, mutant RUNX2 3′-UTR or no 3′-UTR (control) were co-transfected with miR-30a-3p mimic or non-targeting control miRNA in BEAS-2B cells. After 24 h, cells were harvested and lysed and luciferase activity was measured with a Dual-Luciferase Reporter Assay Kit (Promega, USA). The firefly luciferase activity was normalized to renilla luciferase activity. To investigate whether RUNX2 binds to the promoter of HMGB1, the wild type, truncated, or mutant HMGB1 promoters were cloned into a pPro-RB-Report vector (RiboBio, China). These luciferase vectors were co-transfected with empty control or RUNX2 cDNA expression vector in BEAS-2B cells. After 24 h, cells were harvested and luciferase activity was measured with a Dual-Luciferase Reporter Assay Kit (Promega, USA). The renilla luciferase activity was normalized to firefly luciferase activity.

To confirm the direct interaction of miR-4649-5p with the putative target PIP5K1C, a 60 nt region of the 3′ UTR of PIP5K1C containing a predicted binding site for the miRNA was inserted into the dual luciferase reporter vector pEZX-MT06 (Genecopoeia, Rockville, MD, USA). Both the wild-type (5′ CCCCAAACACTGGTTTGCATCCCAGGTTCCTCGCCCACCTACCCCCGCCACACCCCGTCT 3′) and a mutated binding site sequence (5′ CCCCAAACACTGGTTTGCATCGTAGGTTCCAGGTTCACCTACCCCCGCCACACCCCGTCT 3′) were used. An empty control plasmid (CmiT000001-MT06; Genecopoeia) was employed as a reference control. For the luciferase assay, HEK293 cells were seeded in 24-well plates. Once cells reached 70–80% confluence they were co-transfected with 200 ng pEZ-MT06 PIP5K1C wt/mutated reporter vector or control vector and 50 nM mirVana™ miR-4649-5p mimic or mirVana™ mimic control (Thermo Fisher Scientific) using Lipofectamine 2000 Transfection Reagent (Thermo Fisher Scientific) and Opti-MEM Reduced Serum Medium (Thermo Fisher Scientific) according to the manufacturer’s instructions. Cells were harvested 24 h after transfection and the Luc-Pair Luciferase Assay Kit 2.0 (Genecopoeia) was performed according to the user manual. Luminescence was measured with a LUMIStar Omega luminometer (BMG LabTech). The firefly luciferase signals were normalized by the renilla luciferase signals.