Ago2 antibody

Manufactured by Fujifilm

Sourced in United States

The Ago2 antibody is a laboratory reagent used for the detection and analysis of the Argonaute 2 (Ago2) protein. Ago2 is a key component of the RNA-induced silencing complex (RISC) and plays a crucial role in the RNA interference (RNAi) pathway. The Ago2 antibody allows for the identification and study of Ago2 in various cellular and experimental contexts.

Automatically generated - may contain errors

Lab products found in correlation

Proteinase k, by Thermo Fisher Scientific (2 mentions) Mabe56, by Merck Group (1 mentions) Superscript 3 cdna synthesis kit, by Thermo Fisher Scientific (1 mentions) Gw182 antibody, by Santa Cruz Biotechnology (1 mentions) Protein a g agarose bead, by Santa Cruz Biotechnology (1 mentions) G dynabeads, by Thermo Fisher Scientific (1 mentions) α tubulin antibody, by Merck Group (1 mentions) Dynabeads protein g, by Thermo Fisher Scientific (1 mentions) Trizol reagent, by Thermo Fisher Scientific (1 mentions) Dynabeads protein g magnetic particles, by Thermo Fisher Scientific (1 mentions) Mouse igg, by Santa Cruz Biotechnology (1 mentions) Mirneasy mini kit, by Qiagen (1 mentions) Laemmli sample buffer, by Bio-Rad (1 mentions)

6 protocols using ago2 antibody

RNA-Seq Analysis of LCMV-Specific CD8+ T Cells

Cited 2 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

Cross-linking was performed using 5 million sorted LCMV-Specific CD8⁺ T cells 12 dpi according to a published protocol (Guo et al., 2014 (link)). RNA immunoprecipitation was performed with 10 µg pan-AGO antibody (MABE56; Millipore) and Ago2 antibody (015–22031; Wako Chemical), and quantitative RT-PCR was performed following a published protocol (Guo et al., 2015 (link)). RT reaction was performed using the Invitrogen Superscript III cDNA synthesis kit according to the manufacturer’s protocol. Sybr-based quantitative PCR was performed with the following primers: set-1 forward, 5′-GCAGTTCAGCCAAGACAGAG-3′: set-1 reverse, 5′-TGTAGTGATACATACGTAGAGTGCAA-3′; set-2 forward, 5′-CTGCAAGTGCCATCCTTGTA-3′; set-2 reverse, 5′-TGACCTAAAATTAAATGAATGCAAA-3′; set-3 forward, 5′-TTTAAAAGGTGCCCGCACTA-3′; set-3 reverse, 5′-TGCATCACTTCAAGTTCCTTCA-3′; set-4 forward, 5′-GGCAGCAGTTCCTTAGTTTACA-3′; set-4 reverse, 5′-GCCCAAATGATCAACGTCAT-3′; set-5 forward, 5′-GGCAGAATCAGTGTTCGTGA-3′; set-5 reverse, 5′-CAACAAACGAATCAACAACTGC-3′; set-6 forward, 5′-CAGTAGAGATGCAGTTGGTTCC-3′; set-6 reverse, 5′-AAAACTGGGGAAAGGGAGAA-3′; set-7 forward, 5′-AGGTTACAGGAGGCTGGATG-3′; set-7 reverse, 5′-TGCTCTGTGAAGGGAATTCTG-3′; set-8 forward, 5′-TTTGGTTCACAGCCGTTTTC-3′; and set-8 reverse, 5′-AAAAGTACGTGTCAGTAAGAAGGGTA-3′.

Guan T., Dominguez C.X., Amezquita R.A., Laidlaw B.J., Cheng J., Henao-Mejia J., Williams A., Flavell R.A., Lu J, & Kaech S.M. (2018). ZEB1, ZEB2, and the miR-200 family form a counterregulatory network to regulate CD8+ T cell fates. The Journal of Experimental Medicine, 215(4), 1153-1168.

+ Open protocol

+ Expand

Immunoprecipitation of Argonaute Proteins

Cited 2 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

Immunoprecipitation of Argonaute proteins from chondrocytes stimulated with IL-1β for 1 hour was performed as described previously [25 (link), 26 (link)] using Protein A/G Agarose beads (Santa Cruz, Cat # SC2003) and AGO2 antibody (Wako Chemicals Cat # 011-22033) and GW182 antibody (Santa Cruz # sc-56314) for GW182 immunoprecipitation. tRFs were amplified and detected as described above.

Green J.A., Ansari M.Y., Ball H.C, & Haqqi T.M. (2020). tRNA-Derived Fragments (tRFs) Regulate Post-Transcriptional Gene Expression via AGO-Dependent Mechanism In IL-1β Stimulated Chondrocytes. Osteoarthritis and cartilage, 28(8), 1102-1110.

+ Open protocol

+ Expand

Quantification of Ago2-bound siRNA

Cited 2 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

Cells were lysed at 7 h post-transfection using ice-cold lysis buffer (50 mM Tris-HCl at pH 7.5, 200 mM NaCl, 0.5% Triton, 2 mM EDTA, 1 mg mL^-1 heparin, and protease inhibitor cocktail)^{42 (link),43 (link)}. Ago2 antibody (Wako Chemicals, 015-22031, 20 μL) was absorbed onto magnetic protein G Dynabeads (Invitrogen, 40 μL) by incubation at 4 °C for 2 h on a rotator. The beads were then washed twice with lysis buffer to remove unbound antibodies. Following washing, beads were incubated with protein lysate (360 μg) overnight at 4 °C on a rotator. Following removal of unbound proteins, bound material was eluted from beads using 50 μL of 0.1 M glycine (pH 2.3) for 15 min at RT. Eluted fractions were neutralized immediately with an equal volume of 1 M Tris-HCl (pH 8) and then treated with 20 U of proteinase K for 10 min at 65 °C^{44 (link)}. The amount of Ago2-bound siRNA was then quantified using stem loop PCR technique. For the biotin-siRNA pull down experiment, strepavidin beads were blocked and incubated with cell lysates at 4 °C for 2 h^{42 (link)}. The amount of siRNA-associated Ago2 was quantified via Western blotting.

Wu S.Y., Yang X., Gharpure K.M., Hatakeyama H., Egli M., McGuire M.H., Nagaraja A.S., Miyake T.M., Rupaimoole R., Pecot C.V., Taylor M., Pradeep S., Sierant M., Rodriguez-Aguayo C., Choi H.J., Previs R.A., Armaiz-Pena G.N., Huang L., Martinez C., Hassell T., Ivan C., Sehgal V., Singhania R., Han H.D., Su C., Kim J.H., Dalton H.J., Kowali C., Keyomarsi K., McMillan N.A., Overwijk W.W., Liu J., Lee J.S., Baggerly K.A., Lopez-Berestein G., Ram P.T., Nawrot B, & Sood A.K. (2014). 2’f-OMe-phosphorodithioate modified siRNAs show increased loading into the RISC complex and enhanced anti-tumour activity. Nature communications, 5, 3459.

+ Open protocol

+ Expand

Depleting Ago2 and Dicer in Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

shRNA-Ago2 and shRNA-DICER depletion was done as described previously^{68 (link)} Briefly, shControl was from Millipore-Sigma (pLKO.1, SHC001). shAGO2 and shDICER were from Millipore-Sigma (TRCN#255786 and TRCN#71321, respectively) Sequence for Ago2 is CCGGATCGAACATGAGACGTCTTTGCTCGAGCAAAGACGTCTCATGTTCGATTTTTTG and for DICER CCGGGCTGGGATGATGGTAAGAGAACTCGAGTTCTCTTACCATCATCCCAGCTTTTTG. Ago2 primers are as follows: amplicon size 138, Forward Primer TGAAGAACACATACGCTGGC, Reverse Primer TCTGCACGTTCTTCATCTGG. DICER TaqMan assay Mm052172_m1. Ago2 antibody was from Wako Chemicals USA (Cat. 018-22021); α-tubulin antibody was from Millipore-Sigma (Cat. T9026). For shRNA knockdown experiments, lentiviral particles expressing shRNA against control and Ago2 mRNAs were prepared and propagated in HEK293T cells. After two rounds of lentiviral infection, cells were selected under puromycin (2 μg/ml) for 2 days. Selected cells were separated to plates with media in the absence of puromycin and followed by designated treatment.

Blumental-Perry A., Jobava R., Bederman I., Degar A.J., Kenche H., Guan B.J., Pandit K., Perry N.A., Molyneaux N.D., Wu J., Prendergas E., Ye Z.W., Zhang J., Nelson C.E., Ahangari F., Krokowski D., Guttentag S.H., Linden P.A., Townsend D.M., Miron A., Kang M.J., Kaminski N., Perry Y, & Hatzoglou M. (2020). Retrograde signaling by a mtDNA-encoded non-coding RNA preserves mitochondrial bioenergetics. Communications Biology, 3, 626.

+ Open protocol

+ Expand

Immunoprecipitation of Ago2-Bound RNA

Check if the same lab product or an alternative is used in the 5 most similar protocols

RIP experiments were performed as described previously [15] (link), [16] (link). In brief, the liver tissue from 16-hr fasted and random-fed C57BL/6 mice was lysed using an equal volume of lysis buffer (20 mM Hepes, 150 mM NaCl, 1 mM CaCl₂, 1 mM Mg Cl₂). After 5 min incubation on ice, lysates were frozen at −80 °C to enhance lysis. Samples were thawed on ice and spun for 15 min at 13,000 g and 4 °C to remove cell debris. Ago2 antibody (Wako cat. no. 018–22021) was incubated with Dynabeads Protein G (Invitrogen, 10004D) was on a rotating wheel for 4 h at 4 °C and beads were washed 5 times with wash buffer. Mouse IgG1 antibody was used as a negative control. Cleared lysates were incubated with beads overnight at 4 °C. Afterwards, beads were washed 5 times with elution buffer. RNA was extracted using the TRIzol reagent (Life Technologies). Incorporated mRNA or miRNA was quantified using qPCR and normalized by RNA from 10% input lysate.

Yan X., Wang Z., Bishop C.A., Weitkunat K., Feng X., Tarbier M., Luo J., Friedländer M.R., Burkhardt R., Klaus S., Willnow T.E, & Poy M.N. (2018). Control of hepatic gluconeogenesis by Argonaute2. Molecular Metabolism, 18, 15-24.

+ Open protocol

+ Expand

UV-Crosslinking and RNA Immunoprecipitation

Check if the same lab product or an alternative is used in the 5 most similar protocols

Dissociated‐EB6 were resuspended in PBS (without Ca²⁺ and Mg²⁺) and plated in dishes (10 × 10 cm²). Cells were UV cross‐linked with 4,000 µJoules/cm² energy using a stratalinker and centrifuged at 200 g for 5 min at 4°C. Cell pellets were resuspended in 3 volumes of NP40 lysis buffer pH 7.5 (50 mM Hepes‐KOH; 150 mM KCl; 2 mM EDTA; 1 mM NaF; 0.5% NP40; 0.5 mM DTT; 1× PIC) and incubated on ice for 10–15 min followed by centrifugation at 18,000 g for 10 min at 4°C. Resulting cellular lysates were incubated (overnight on a rotating wheel, at 4°C) with 30 µl of Dynabeads Protein G magnetic particles (Invitrogen) preincubated with either 10 μg of Ago2 Antibody (018‐22021, Wako) or mouse IgG (sc‐2025, Santa Cruz). Beads were washed with a High‐Salt buffer (50 mM Hepes‐KO; 500 mM KCl; 0.5 mM DTT; 0.05% NP40). Before RNA extraction, 1/5 of the cell lysate was heated for 5 min at 95°C, and the supernatant was collected and resuspended in Protein elution buffer (4× Laemmli sample buffer [BioRad]) with DTT 50 mM and analyzed by Western blot. RNA fraction was treated with Proteinase K (AM2546, Thermo Fisher Scientific) for 30 min at 50°C; the samples were then placed for 10 min at 95°C, and finally, the RNA was extracted using miRNeasy Mini Kit with on‐column DNAse treatment, according to the manufacturer’s instructions (Qiagen).

Carvelli A., Setti A., Desideri F., Galfrè S.G., Biscarini S., Santini T., Colantoni A., Peruzzi G., Marzi M.J., Capauto D., Di Angelantonio S., Ballarino M., Nicassio F., Laneve P, & Bozzoni I. (2022). A multifunctional locus controls motor neuron differentiation through short and long noncoding RNAs. The EMBO Journal, 41(13), e108918.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!