Log In Sign up
The largest database of trusted experimental protocols

Cfx real time pcr thermocycler

Manufactured by Bio-Rad
Visit Supplier

The CFX Real‐Time PCR thermocycler is a laboratory instrument used for amplifying and detecting specific DNA sequences in real-time. It is designed to precisely control temperature for the thermal cycling process required for polymerase chain reaction (PCR) experiments.

Automatically generated - may contain errors

Lab products found in correlation

Iscript cdna synthesis kit, by Bio-Rad (3 mentions) Quick rna miniprep kit, by Zymo Research (1 mentions) Nanodrop 2000, by Thermo Fisher Scientific (1 mentions) Iq syber green, by Bio-Rad (1 mentions) Rneasy mini kit, by Qiagen (1 mentions) Nanodrop nd 1000, by Thermo Fisher Scientific (1 mentions) Taqman reverse transcription reagent, by Thermo Fisher Scientific (1 mentions) Ssoadvanced universal sybr green master mix, by Bio-Rad (1 mentions) Nanodrop spectrophotometer, by Bio-Rad (1 mentions) Mirneasy kit, by Qiagen (1 mentions) Cfx maestro software, by Bio-Rad (1 mentions) Nanodrop 2000 spectrophotometer, by Thermo Fisher Scientific (1 mentions)

Spelling variants of this product

Thermocycler (392 citations) CFX thermocycler (43 citations) PCR thermocycler (27 citations) CFX Connect Real-Time PCR thermocycler (8 citations) CFX Real Time thermocycler (7 citations) CFX Connect Real-Time PCR Detection System thermocycler (6 citations)

4 protocols using cfx real time pcr thermocycler

1

Quantitative Real-Time PCR Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was isolated using Quick‐RNA MiniPrep kit (Zymo Research, R1055) following manufacturer's protocol. RNA concentration was determined using NanoDrop 2000 spectrophotometer (ThermoFisher) and normalized to 500 ng for cDNA synthesis by iScript cDNA synthesis kit (BioRad, 170‐8891). Of note, 6.5 ng of cDNA was used for each qPCR reaction using iQ SYBER Green (BioRad, 170‐8882) on a CFX Real‐Time PCR thermocycler (BioRad). Primers and sequences used in this study are listed in Table S2. Ct values were normalized to Actb and analyzed by the ∆∆Ct method relative to ESCs.
Wang B.J., Alvarez R J.r., Muliono A., Sengphanith S., Monsanto M.M., Weeks J., Sacripanti R, & Sussman M.A. (2019). Adaptation within embryonic and neonatal heart environment reveals alternative fates for adult c‐kit+ cardiac interstitial cells. Stem Cells Translational Medicine, 9(5), 620-635.
+ Open protocol
+ Expand
2

RNA Extraction and qRT-PCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was extracted using an RNeasy Mini kit (Qiagen, Valencia, CA). After spectrophotometric assessment for quality and concentration (Nanodrop ND-1000; Thermo Scientific, Nashville, TN), total RNA (96.25 ng) was reverse-transcribed into cDNA using the Taqman™ Reverse Transcription reagents (Thermo Scientific). Reactions were performed in a 25 μL final volume containing 4 μL cDNA, 12.5 μL Taqman™ PCR Mix (2X), and 1.25 μL of each primer using a Bio-Rad CFX Real time PCR thermocycler. Relative levels of gene expression are reported as actin-normalized fold change using the 2ΔΔCT quantification methods (14 (link), 15 (link)). The following TaqMan™ primers were used: IL-6 (Hs99999032_m1), TNF-α (Hs99999043_s1), and IL-1β (Hs99999029_m1), ACTB (Hs01060665_g1), ABCA1 (Mm00442646_m1), ABCG1 (Mm00437390_m1), SCRB1 (Mm00450236_m1), and ACTB (Mm02619580_g1) (Applied Biosystems, Foster City, California).
Sarkar S., Tsuchida Y., Diab R., Xu C., Yermalitsky V., Davies S.S., Ikizler T.A., Hung A.M., Kon V, & Flynn C.R. (2020). Pro-Inflammatory HDL in Women with Obesity and Nonalcoholic Steatohepatitis. Obesity research & clinical practice, 14(4), 333-338.
+ Open protocol
+ Expand
3

Quantitative RNA Expression Analysis of Retinoblastoma

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA from the RB tumors (n = 5) and control retina (n = 2) was isolated by the TRIzol Reagant method. DNA contamination was removed by DNase treatment. The extracted RNA was quantified using a Thermo Scientific NanoDrop spectrophotometer, and cDNA was prepared using the iScript cDNA synthesis kit (Bio-Rad, Hercules, CA, USA). Quantitative real time PCR (RT-PCR) was then performed in a CFX Real Time PCR Thermo Cycler (Bio-Rad) using the SsoAdvanced Universal SYBR Green Master Mix (Bio-Rad) according to the manufacturer's protocols. The primers used for amplification of CD81, CD9, CD63, and glyceraldehyde 3-phosphate dehydrogenase (GAPDH) are listed in Supplementary Table S1. The relative quantity of target mRNA against the standard reference gene (GAPDH) was calculated according to the 2−∆∆Ct method.21 (link) Student's t-test was used to compare the normalized mRNA expression levels. P < 0.05 was considered to be statistically significant.
Manukonda R., Jakati S., Attem J., Mishra D.K., Mocherla T.R., Reddy M.M., Gulati K., Poluri K.M., Vemuganti G.K, & Kaliki S. (2023). Identifying Treatment Resistance Related Pathways by Analyzing Serum Extracellular Vesicles of Patients With Resistant Versus Regressed Retinoblastoma. Investigative Ophthalmology & Visual Science, 64(11), 26.
+ Open protocol
+ Expand
4

Quantification of RyR1 and RyR2 Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was isolated from cells using Qiagen miRNeasy kit (217004). RNA quantity and quality were assayed using a Nanodrop 2000 spectrophotometer (Thermo-Fisher). RNA was then converted to cDNA using an iScript cDNA synthesis kit (Bio-Rad, 1708891). Once cDNA was made, qPCR was run on a CFX Real-Time PCR thermocycler (Bio-Rad) using human RyR1 (Bio-Rad, 10025636), RyR2 (F: GAGGGACTTCCACAAAGCGA and R: GGCATGTGCTCAGAGAGGTT), and GAPDH (F: GAAGGTGAAGGTCGGAGTC and R: GAAGATGGTGATGGGATTTC) primers. Quantification was done using CFX Maestro software (Bio-Rad).
Sermersheim M., Kenney A.D., Lin P.H., McMichael T.M., Cai C., Gumpper K., Adesanya T.M., Li H., Zhou X., Park K.H., Yount J.S, & Ma J. (2020). MG53 suppresses interferon-β and inflammation via regulation of ryanodine receptor-mediated intracellular calcium signaling. Nature Communications, 11, 3624.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!