Taqman gene expression assays and universal pcr master mix

Tissues from the biopsy site were excised 0, 24, 48 h after wound creation. Wound site tissues taken from the 2–3 mm surrounding the wound edge were immediately frozen after collection. Total RNA was extracted from the wound site using ISOGEN II reagent (Nippon Gene, Tokyo, Japan), and first-strand cDNA was synthesized using the High Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Foster City, CA). Quantitative real-time RT-PCR was performed using specific primer–probe sets to amplify VEGF mRNA with TaqMan^® Gene Expression Assays and Universal PCR Master Mix (Applied Biosystems) or to amplify IL-6, TNF-α, MMP-2, MMP-9 and EGF mRNA with QuantiTect SYBR Green PCR Master Mix (Qiagen GmbH, Hilden, Germany). Each sample was analyzed on a Light-Cycler^® 480 system (Roche Diagnostic Systems, Basel, Switzerland). The expression level of each gene was normalized against that of GAPDH mRNA. The primer sequences used for qRT-PCR were as follows: IL-6-fwd, TCCAGTTGCCTTCTTGGGAC; IL-6-rev, GTACTCCAGAAGACCAGAGG; TNF-α-fwd, CACAGAAAGCATGATCCGCGACGT; TNF-α -rev, CGGCAGAGAGGAGGTTGACTTTCT; MMP-2-fwd, CCCCTGATGTCCAGCAAGTAGA; MMP-2-rev, AGTCTGCGATGAGCTTAGGGAAA; MMP-9-fwd, CCCTGGAACTCACACGACATCTTC; MMP-9-rev, GGTCCACCTTGTTCACCTCATTTT; EGF-fwd, ATGGGAAACAATGTCACGAAC; EGF-rev, TGTATTCCGTCTCCTTGGTTC; GAPDH-fwd, TGCACCACCAACTGCTTAG; and GAPDH-rev, GGATGCAGGGATGATGTTC.