Quickchange xl site directed mutagenesis kit

WT GluK2(R) cDNA provided by Steve Heinemann (Salk Institute, La Jolla, CA) was subcloned into pcDNA3 for expression in human embryonic kidney (HEK293) cells. Conversion to glutamine at the Q/R site and cysteine substitutions along the GluK2 M3 helix were prepared as described (Wilding et al., 2008 (link)) using the QuickChange XL site-directed mutagenesis kit (Agilent Technologies). Additional subunit cDNAs provided by Mark Mayer (National Institutes of Health, Bethesda, MD), Peter Seeburg (Max Planck Institute, Heidelberg, Germany), and Stefano Vicini (Georgetown University, Washington, DC) were used to construct chimeric subunits as previously described (Wilding et al., 2014 (link)). Residue substitutions in chimeric subunits were generated by PCR. All constructs were verified by sequencing in the Washington University protein and nucleic acid chemistry laboratory. The HEK293 cells at ∼60% confluence were transfected with 1–3 µg of subunit cDNA using lipofectamine 2000 (Thermo Fisher Scientific). Coexpression of GFP from a second plasmid was used to identify transfected cells. On the day after transfection, cells were dissociated with mild protease treatment and replated at low density on nitrocellulose-treated 35-mm dishes (Wilding et al., 2008 (link)). Physiological recordings were obtained from green fluorescent cells 24–48 h after replating.

Soluble forms of the 3Fn minireceptor containing two, four, or six 3Fn-domains (s3Fn1-2, s3Fn1-4, and s3Fn1-6) was generated by site-directed mutagenesis introducing stop codons in the predicted 3Fn-domain boundaries. Primers were designed following instructions from the manufacturer: s3Fn1-2: fwd; 5′-CATTACCACCATAAAAGGATGAGTGATCCCACCACCAGATATC-3′, rev; 5′-GATATCTGGTGGTGGGATCACTCATCCTTTTATGGTGGTAATG-3′, s3Fn1-4: fwd; 5′-GTTGTAGTGAAGATGATCTGAGACAGCAGGCTTCCACCC-3′, rev; 5′-GGGTGGAAGCCTGCTGTCTCAGATCATCTTCACTACAAC-3′ and s3Fn1-6: fwd: 5’-CCTGCTGTACGATGAGTGAGGGTCTGGTGCAGATGC-3′, rev: 5′-GCATCTGCACCAGAC CCTCACTCATCGTACAGCAGG-3’). Site-directed mutagenesis was performed with the FLAG-mini construct as template and using the Quickchange XL site-directed mutagenesis kit (#20052, Agilent) following the protocol from the manufacturer. For the production of the SORLA VPS10p-domain T659C mutant, the corresponding sequence was amplified with the wild-type plasmid as template and the primer pair (fwd: 5′-TGCTTCAATGGAGAGGACTTTGACAGGCCG-3′, rev: 5′- ACAGGCATGGGGGGTCCGCC -3′), and circularized by the ligation reaction with T4 PNK (New England Biolabs Inc. M0201).