Sybr fast qpcr kit

RNA was isolated using Trizol reagent (MRC, Cincinnati, OH), and subsequent RT-PCR was carried out using ReverTra Ace^® qPCR RT Master Mix (TOYOBO). Quantitative real-time PCR was performed with a SYBR FAST qPCR kit (KAPA) in a Thermal Cycler Dice (Takara, Otsu, Shiga, Japan) according to the manufacturer's instructions. The C(t) value was normalized using GAPDH as a control. The following primers were used: GAPDH (FWD: 5′-TCA GTG GTG GAC CTG ACC TGA CC-3′, RV: 5′-TGC TGT AGC CAA ATT CGT TGT CAT ACC-3′), galectin-1 (FWD: 5′-CAA CCC TCG CTT CAA CGC CCA CG-3′, RV: 5′-CGT ATC CAT CTG GCA GCT TGA CGG-3′), and survivin (FWD: 5′-CTT GGA GGG CTG CGC CTG CAC CC-3′, RV: 5′-CTG GCT CCC AGC CTT CCA GCT CCT TG-3′).

Total RNA was extracted according to the procedure of Chomczynzki and Sacchi (68 (link)) using Trizol reagent (Bio-Rad, Munich). Complementary DNA (cDNA) was prepared from 2 µg of total RNA using the ImProm-II™ Reverse Transcription System (Promega, Madison) according to the manufacturers’ instructions. qRT-PCR assays were performed using SYBR^® FAST qPCR kit (KapaBiosystems) in a reaction volume of 20 µl. All amplifications were performed as follows: initial denaturation at 95°C for 5 min, followed by 45 cycles at 95°C for 30 s, and 60°C for 20 s, and 72°C for 5 s. Analyzed genes were amplified in triplicate using the Light Cycler 480II (Roche) and normalized to GAPDH expression in the same sample using the efficiency corrected comparative Ct model. A list of the primers used and their annealing temperatures is shown in Table 4.

The expression level of the gene VdThit (VDAG_03620) encoding a thiamine transport protein was measured in the Vd-wt strain, ΔVdTHI20 mutant strains, and complemented ΔVdTHI20-c strains. Total RNA was extracted from each V. dahliae strain using the RNA miniprep kit (Axygen, Union City, CA, USA) according to the manufacturer’s instructions. cDNAs were synthesized using a Toyobo RT kit (Osaka, Japan). qRT-PCR was performed with the SYBR Fast qPCR kit (Kapa Biosystems, Boston, MA, USA). The expression level of VdThit was quantified using the β-tubulin gene (DQ266153) as an internal reference, which was amplified with the primer pair VdThit-F and VdThit-R (Table 2). The qRT-PCRs were performed on an ABI QuantStudio 6 flex PCR thermocycler (Applied Biosystems, Foster City, CA, USA) and repeated three times.

Total RNA was extracted using the RNeasy Plus Mini Kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions. The qRT-PCR was performed using an SYBR FAST qPCR kit (Kapa Biosystems, Wilmington, MA, USA) on an Applied 7300 real-time PCR system (ABI Biosystems; Thermo Fisher Scientific, Foster City, CA, USA). Relative mRNA levels were determined by normalizing the obtained expression levels to the endogenous GAPDH mRNA levels. The relative transcript levels of the control sample were set to 1, and the transcript levels of other samples were normalized to that of the control. qRT-PCR reactions were performed in triplicate using the primers presented in Supplementary Table S2 (see Supplementary experimental procedures).

Total RNA was extracted by Quick-RNA^TM MiniPrep Kit (Zymo Research Corporation, Irvine, CA, USA). For miR-494-3p detection, 100 ng extracted RNA was used for complementary DNA (cDNA) synthesis with RevertAid First Strand cDNA Synthesis Kit (Thermo Fisher Scientific Inc.) and a specific RT primer (RiboBio Co., Ltd.). qPCR was performed on an ABI StepOnePlus™ Real-Time PCR System (Applied Biosystems, Life Technologies Corp., Carlsbad, CA, USA) by SYBR Green reagent (SYBR^® FAST qPCR Kit, Kapa Biosystems, Inc., Wilmington, MA, USA) with specific primers purchased from RiboBio Co., Ltd. and analyzed with the StepOne software (Applied Biosystems). For Bmi1 detection, 1 μg of extracted RNA was used for cDNA synthesis with random hexamers provided in RevertAid First Strand cDNA Synthesis Kit followed by SYBR Green based qPCR reaction. The primer sequences were listed as followed:

Bmi1

Forward: 5′-AATCCCCACCTGATGTGTGT-3′

Reverse: 5′-GCTGGTCTCCAGGTAACGAA-3′

MRPL19 (internal control)

Forward: 5′-GGGATTTGCATTCAGAGATCAG-3′

Reverse: 5′-GGAAGGGCATCTCGTAAG-3′

qPCR data were analyzed as previous described [28 (link)].

A two-step PCR generated rbcL and ndhJ barcodes from scat/autopsy samples. First, the following Illumina sequences were added to the 5' end of primers:
F: TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG,
R: GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG.
Initial amplification was performed in 20μl of: 1x MyFi Buffer, 1.6U MyFi Polymerase (Bioline), 200 pM of each forward and reverse primers, and 20 ng DNA. PCR conditions for rbcL and ndhJ: 95°C (1 min) followed by 35 cycles of 95°C 15 s, 55°C 15 s, 72°C 15 s. Products were purified using the Agencourt AMPure XP PCR Purification beads at a v/v ratio of 0.6x beads/PCR product.
Second PCR was performed in 12.5 μl volumes of: 1x MyFi Buffer (Bioline,); 0.4 nM of paired Nextera 96 Indices (Illumina); 1.6U MyFi Polymerase (Bioline) and 2 μl of purified initial amplicon. Thermocycling conditions were: 95°C 1 min, then 5 cycles 95°C 5 s, 55°C 10 s, 72°C 10 s. Products were purified as above and quantified by qPCR calibrated to known PhiX standards (Illumina) using the SYBR FAST qPCR Kit (Kapa Biosystems) on a RotorGene RG-6000 (Corbett).
Indexed libraries were pooled and 16 pM aliquots were paired-end sequenced on a MiSeq sequencer using a 600-cycle Version 3 kit (Illumina). The MiSeq Bcl output files were de-multiplexed and converted to FASTQ files using MiSeq Reporter v2.6 software (Illumina).